Human SOCS1/CIS1/CISH1 ORF/cDNA clone-Lentivirus particle (NM_003745)

Cat. No.: vGMLP003452

Pre-made Human SOCS1/CIS1/CISH1 Lentiviral expression plasmid for SOCS1 lentivirus packaging, SOCS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SOCS1/CIS1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP003452 Human SOCS1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP003452
Gene Name SOCS1
Accession Number NM_003745
Gene ID 8651
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 636 bp
Gene Alias CIS1,CISH1,JAB,SOCS-1,SSI-1,SSI1,TIP-3,TIP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGACGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGGCCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCGCACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTACTGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACCTTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCCTCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGCCGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAGCGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTCCGCGACTACCTGAGCTCCTTCCCCTTCCAGATTTGA
ORF Protein Sequence MVAHNQVAADNAVSTAAEPRRRPEPSSSSSSSPAAPARPRPCPAVPAPAPGDTHFRTFRSHADYRRITRASALLDACGFYWGPLSVHGAHERLRAEPVGTFLVRDSRQRNCFFALSVKMASGPTSIRVHFQAGRFHLDGSRESFDCLFELLEHYVAAPRRMLGAPLRQRRVRPLQELCRQRIVATVGRENLARIPLNPVLRDYLSSFPFQI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06800-Ab Anti-SOCS1 monoclonal antibody
    Target Antigen GM-Tg-g-T06800-Ag SOCS1 protein
    ORF Viral Vector pGMLP003452 Human SOCS1 Lentivirus plasmid
    ORF Viral Vector pGMLV000858 Human SOCS1 Lentivirus plasmid
    ORF Viral Vector pGMPC000656 Human SOCS1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001717 Human SOCS1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP003452 Human SOCS1 Lentivirus particle
    ORF Viral Vector vGMLV000858 Human SOCS1 Lentivirus particle


    Target information

    Target ID GM-T06800
    Target Name SOCS1
    Gene ID 8651, 12703, 711180, 252971, 111558242, 490006, 518795, 102148488
    Gene Symbol and Synonyms AISIMD,CIS1,CISH1,Cish7,JAB,SOCS-1,SOCS1,SSI-1,SSI1,TIP-3,TIP3
    Uniprot Accession O15524
    Uniprot Entry Name SOCS1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000185338
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.