Human SOCS1/CIS1/ CISH1 ORF/cDNA clone-Lentivirus plasmid (NM_003745)
Pre-made Human SOCS1/CIS1/ CISH1 Lentiviral expression plasmid for SOCS1 lentivirus packaging, SOCS1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SOCS1/CIS1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003452 | Human SOCS1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003452 |
Gene Name | SOCS1 |
Accession Number | NM_003745 |
Gene ID | 8651 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 636 bp |
Gene Alias | CIS1, CISH1, JAB, SOCS-1, SSI-1, SSI1, TIP-3, TIP3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGACGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGGCCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCGCACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTACTGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACCTTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCCTCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGCCGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAGCGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTCCGCGACTACCTGAGCTCCTTCCCCTTCCAGATTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T06800-Ab | Anti-SOCS1 monoclonal antibody |
Target Antigen | GM-Tg-g-T06800-Ag | SOCS1 protein |
ORF Viral Vector | pGMLV000858 | Human SOCS1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000656 | Human SOCS1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP003452 | Human SOCS1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000858 | Human SOCS1 Lentivirus particle |
ORF Viral Vector | vGMLP003452 | Human SOCS1 Lentivirus particle |
Target information
Target ID | GM-T06800 |
Target Name | SOCS1 |
Gene ID | 8651, 12703, 711180, 252971, 111558242, 490006, 518795, 102148488 |
Gene Symbol and Synonyms | AISIMD,CIS1,CISH1,Cish7,JAB,SOCS-1,SOCS1,SSI-1,SSI1,TIP-3,TIP3 |
Uniprot Accession | O15524 |
Uniprot Entry Name | SOCS1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000185338 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.