Human SOCS1/AISIMD/ CIS1 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_003745.2)

Pre-made Human SOCS1/AISIMD/ CIS1 Non-Viral expression plasmid (overexpression vector) for mouse SOCS1 overexpression in unique cell transient transfection and stable cell line development.

Target products collectionGo to SOCS1/AISIMD products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMPC000656 Human SOCS1 Mammalian (Non-Viral Vector) plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMPC000656
Gene Name SOCS1
Accession Number NM_003745.2
Gene ID 8651
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 636 bp
Gene Alias AISIMD, CIS1, CISH1, JAB, SOCS-1, SSI-1, SSI1, TIP-3, TIP3
Fluorescent Reporter
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTAGCACACAACCAGGTGGCAGCCGACAATGCAGTCTCCACAGCAGCAGAGCCCCGACGGCGGCCAGAACCTTCCTCCTCTTCCTCCTCCTCGCCCGCGGCCCCCGCGCGCCCGCGGCCGTGCCCCGCGGTCCCGGCCCCGGCCCCCGGCGACACGCACTTCCGCACATTCCGTTCGCACGCCGATTACCGGCGCATCACGCGCGCCAGCGCGCTCCTGGACGCCTGCGGATTCTACTGGGGGCCCCTGAGCGTGCACGGGGCGCACGAGCGGCTGCGCGCCGAGCCCGTGGGCACCTTCCTGGTGCGCGACAGCCGCCAGCGGAACTGCTTTTTCGCCCTTAGCGTGAAGATGGCCTCGGGACCCACGAGCATCCGCGTGCACTTTCAGGCCGGCCGCTTTCACCTGGATGGCAGCCGCGAGAGCTTCGACTGCCTCTTCGAGCTGCTGGAGCACTACGTGGCGGCGCCGCGCCGCATGCTGGGGGCCCCGCTGCGCCAGCGCCGCGTGCGGCCGCTGCAGGAGCTGTGCCGCCAGCGCATCGTGGCCACCGTGGGCCGCGAGAACCTGGCTCGCATCCCCCTCAACCCCGTCCTCCGCGACTACCTGAGCTCCTTCCCCTTCCAGATTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T06800-Ab Anti-SOCS1 monoclonal antibody
    Target Antigen GM-Tg-g-T06800-Ag SOCS1 protein
    ORF Viral Vector pGMLV000858 Human SOCS1 Lentivirus plasmid
    ORF Viral Vector pGMPC000656 Human SOCS1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003452 Human SOCS1 Lentivirus plasmid
    ORF Viral Vector vGMLV000858 Human SOCS1 Lentivirus particle
    ORF Viral Vector vGMLP003452 Human SOCS1 Lentivirus particle


    Target information

    Target ID GM-T06800
    Target Name SOCS1
    Gene ID 8651, 12703, 711180, 252971, 111558242, 490006, 518795, 102148488
    Gene Symbol and Synonyms AISIMD,CIS1,CISH1,Cish7,JAB,SOCS-1,SOCS1,SSI-1,SSI1,TIP-3,TIP3
    Uniprot Accession O15524
    Uniprot Entry Name SOCS1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000185338
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the STAT-induced STAT inhibitor (SSI), also known as suppressor of cytokine signaling (SOCS), family. SSI family members are cytokine-inducible negative regulators of cytokine signaling. The expression of this gene can be induced by a subset of cytokines, including IL2, IL3 erythropoietin (EPO), CSF2/GM-CSF, and interferon (IFN)-gamma. The protein encoded by this gene functions downstream of cytokine receptors, and takes part in a negative feedback loop to attenuate cytokine signaling. Knockout studies in mice suggested the role of this gene as a modulator of IFN-gamma action, which is required for normal postnatal growth and survival. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.