Rat Hdac8/HD8/ RGD1562895 ORF/cDNA clone-Adenovirus plasmid (NM_001126373.2)

Pre-made Rat Hdac8/HD8/ RGD1562895 adenoviral expression plasmid for Hdac8 adenovirus packaging, Hdac8 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to HDAC8/Hdac8/HD8 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000844 Rat Hdac8 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000844
Gene Name Hdac8
Accession Number NM_001126373.2
Gene ID 363481
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 1134 bp
Gene Alias HD8, RGD1562895
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGATACCAGAGGAACCCGCCAATAGTGGGCATTCGCTACCCCCGGTTTATATTTACAGTCCCGAGTATGTCAGCATCTGCGATTCCCTTGTGAAGGTCCCCAAACGGGCCAGTATGGTTCACTCTCTGATCGAAGCATATGCCCTGCATAAACAAATGAGGATAGTGAAGCCCAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCCTATCTTCAACATCTCCAGAAGGTCAGCCAAGAAGGGGATGAGGACCATCCAGACTCCATAGAATATGGACTAGGTTATGACTGCCCAGCCACAGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGAGGTACAATCACAGCTGCCCAGTGCCTGATTGACGGGAAGTGTAAAGTAGCCATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTCTGTTATCTCAATGATGCTGTCCTAGGAATATTACGATTGCGACGGAAATTTGACCGGATTCTCTATGTGGACTTGGATCTACACCATGGAGATGGTGTAGAAGATGCCTTCAGTTTTACATCTAAAGTTATGACTGTGTCCCTGCACAAGTTCTCTCCAGGATTTTTCCCAGGAACAGGTGACATGTCTGATGTTGGCCTGGGGAAAGGACGGTACTACAGTGTCAATGTGCCCATTCAGGATGGCATCCAGGATGAGAAGTACTATCACATCTGTGAAAGTGTACTAAAGGAAGTATACCAGGCCTTCAATCCGAAGGCAGTGGTTCTACAGCTGGGAGCAGATACCATTGCTGGAGATCCAATGTGCTCCTTTAACATGACACCAGTGGGAATTGGCAAGTGTCTGAAGTATGTCCTTCAGTGGCAGTTGGCAACTCTGATTTTAGGAGGAGGAGGCTACAACCTTGCCAACACGGCTCGTTGCTGGACATACTTGACCGGGGTCATCCTAGGGAAAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAATCACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCATCGAATCCAGCAAATCCTCAACTACATCAAAGGGAATCTGAAGCATGTGGTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28887-Ab Anti-HDAC8/ CDA07/ CDLS5 monoclonal antibody
    Target Antigen GM-Tg-g-T28887-Ag HDAC8 VLP (virus-like particle)
    ORF Viral Vector pGMAD000844 Rat Hdac8 Adenovirus plasmid
    ORF Viral Vector pGMLP001200 Human HDAC8 Lentivirus plasmid
    ORF Viral Vector vGMAD000844 Rat Hdac8 Adenovirus particle
    ORF Viral Vector vGMLP001200 Human HDAC8 Lentivirus particle


    Target information

    Target ID GM-T28887
    Target Name HDAC8
    Gene ID 55869, 70315, 699642, 363481, 101096383, 480957, 540666, 100052401
    Gene Symbol and Synonyms 2610007D20Rik,CDA07,CDLS5,HD8,HDAC8,HDACL1,KDAC8,MRXS6,RGD1562895,RPD3,WTS
    Uniprot Accession Q9BY41
    Uniprot Entry Name HDAC8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000147099
    Target Classification Not Available

    Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.