Human HDAC8/CDA07/ CDLS5ORF/cDNA clone-Lentivirus plasmid (NM_018486)

SKU: pGMLP001200
Size: 10 µg
Leading Time: 3-7 working days

Pre-made Human HDAC8/CDA07/ CDLS5 Lentiviral expression plasmid for HDAC8 lentivirus packaging, HDAC8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf MSDS
pdf Datasheet
pdf Map
Target products collection

Go to HDAC8/CDA07 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $617.52
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP001200
Gene Name HDAC8
Accession Number NM_018486
Gene ID 55869
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1134 bp
Gene Alias CDA07, CDLS5, HD8, HDACL1, MRXS6, RPD3, WTS
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGAGCCGGAGGAACCGGCGGACAGTGGGCAGTCGCTGGTCCCGGTTTATATCTATAGTCCCGAGTATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCACCATGGAGATGGTGTAGAAGACGCATTCAGTTTCACCTCCAAAGTCATGACCGTGTCCCTGCACAAATTCTCCCCAGGATTTTTCCCAGGAACAGGTGACGTGTCTGATGTTGGCCTAGGGAAGGGACGGTACTACAGTGTAAATGTGCCCATTCAGGATGGCATACAAGATGAAAAATATTACCAGATCTGTGAAAGTGTACTAAAGGAAGTATACCAAGCCTTTAATCCCAAAGCAGTGGTCTTACAGCTGGGAGCTGACACAATAGCTGGGGATCCCATGTGCTCCTTTAACATGACTCCAGTGGGAATTGGCAAGTGTCTTAAGTACATCCTTCAATGGCAGTTGGCAACACTCATTTTGGGAGGAGGAGGCTATAACCTTGCCAACACGGCTCGATGCTGGACATACTTGACCGGGGTCATCCTAGGGAAAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAATCACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCACCGAATCCAACAAATCCTCAACTACATCAAAGGGAATCTGAAGCATGTGGTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T28887-Ab Anti-HDAC8/ CDA07/ CDLS5 monoclonal antibody
    Target Antigen GM-Tg-g-T28887-Ag HDAC8 VLP (virus-like particle)
    ORF Viral Vector pGMAD000844 Rat Hdac8 Adenovirus plasmid
    ORF Viral Vector pGMLP001200 Human HDAC8 Lentivirus plasmid
    ORF Viral Vector vGMAD000844 Rat Hdac8 Adenovirus particle
    ORF Viral Vector vGMLP001200 Human HDAC8 Lentivirus particle


    Target information

    Target ID GM-T28887
    Target Name HDAC8
    Gene ID 55869, 70315, 699642, 363481, 101096383, 480957, 540666, 100052401
    Gene Symbol and Synonyms 2610007D20Rik,CDA07,CDLS5,HD8,HDAC8,HDACL1,KDAC8,MRXS6,RGD1562895,RPD3,WTS
    Uniprot Accession Q9BY41
    Uniprot Entry Name HDAC8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000147099
    Target Classification Not Available

    Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.