Human HDAC8/CDA07/CDLS5 ORF/cDNA clone-Lentivirus particle (NM_018486)
SKU: vGMLP001200
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human HDAC8/CDA07/CDLS5 Lentiviral expression plasmid for HDAC8 lentivirus packaging, HDAC8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
HDAC8/CDA07 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001200 | Human HDAC8 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001200 |
Gene Name | HDAC8 |
Accession Number | NM_018486 |
Gene ID | 55869 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1134 bp |
Gene Alias | CDA07,CDLS5,HD8,HDACL1,MRXS6,RPD3,WTS |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGAGCCGGAGGAACCGGCGGACAGTGGGCAGTCGCTGGTCCCGGTTTATATCTATAGTCCCGAGTATGTCAGTATGTGTGACTCCCTGGCCAAGATCCCCAAACGGGCCAGTATGGTGCATTCTTTGATTGAAGCATATGCACTGCATAAGCAGATGAGGATAGTTAAGCCTAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCTTATCTGCAGCATCTCCAGAAGGTCAGCCAAGAGGGCGATGATGATCATCCGGACTCCATAGAATATGGGCTAGGTTATGACTGCCCAGCCACTGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGGGCTACGATCACAGCTGCCCAATGCCTGATTGACGGAATGTGCAAAGTAGCAATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTTTGTTATCTCAATGATGCTGTCCTGGGAATATTACGATTGCGACGGAAATTTGAGCGTATTCTCTACGTGGATTTGGATCTGCACCATGGAGATGGTGTAGAAGACGCATTCAGTTTCACCTCCAAAGTCATGACCGTGTCCCTGCACAAATTCTCCCCAGGATTTTTCCCAGGAACAGGTGACGTGTCTGATGTTGGCCTAGGGAAGGGACGGTACTACAGTGTAAATGTGCCCATTCAGGATGGCATACAAGATGAAAAATATTACCAGATCTGTGAAAGTGTACTAAAGGAAGTATACCAAGCCTTTAATCCCAAAGCAGTGGTCTTACAGCTGGGAGCTGACACAATAGCTGGGGATCCCATGTGCTCCTTTAACATGACTCCAGTGGGAATTGGCAAGTGTCTTAAGTACATCCTTCAATGGCAGTTGGCAACACTCATTTTGGGAGGAGGAGGCTATAACCTTGCCAACACGGCTCGATGCTGGACATACTTGACCGGGGTCATCCTAGGGAAAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAATCACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCACCGAATCCAACAAATCCTCAACTACATCAAAGGGAATCTGAAGCATGTGGTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T28887-Ab | Anti-HDAC8/ CDA07/ CDLS5 monoclonal antibody |
Target Antigen | GM-Tg-g-T28887-Ag | HDAC8 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001200 | Human HDAC8 Lentivirus plasmid |
ORF Viral Vector | pGMPC001578 | Human HDAC8 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001200 | Human HDAC8 Lentivirus particle |
Target information
Target ID | GM-T28887 |
Target Name | HDAC8 |
Gene ID | 55869, 70315, 699642, 363481, 101096383, 480957, 540666, 100052401 |
Gene Symbol and Synonyms | 2610007D20Rik,CDA07,CDLS5,HD8,HDAC8,HDACL1,KDAC8,MRXS6,RGD1562895,RPD3,WTS |
Uniprot Accession | Q9BY41 |
Uniprot Entry Name | HDAC8_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000147099 |
Target Classification | Not Available |
Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.