- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Rat Hdac8/HD8/ RGD1562895 ORF/cDNA clone-Adenovirus particle (NM_001126373.2)
Pre-made Rat Hdac8/HD8/ RGD1562895 Adenovirus for Hdac8 overexpression in-vitro and in-vivo. The Hdac8 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Hdac8-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to HDAC8/Hdac8/HD8 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAD000844 | Rat Hdac8 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAD000844 |
| Gene Name | Hdac8 |
| Accession Number | NM_001126373.2 |
| Gene ID | 363481 |
| Species | Rat |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 1134 bp |
| Gene Alias | HD8, RGD1562895 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGAGATACCAGAGGAACCCGCCAATAGTGGGCATTCGCTACCCCCGGTTTATATTTACAGTCCCGAGTATGTCAGCATCTGCGATTCCCTTGTGAAGGTCCCCAAACGGGCCAGTATGGTTCACTCTCTGATCGAAGCATATGCCCTGCATAAACAAATGAGGATAGTGAAGCCCAAAGTGGCCTCCATGGAGGAGATGGCCACCTTCCACACTGATGCCTATCTTCAACATCTCCAGAAGGTCAGCCAAGAAGGGGATGAGGACCATCCAGACTCCATAGAATATGGACTAGGTTATGACTGCCCAGCCACAGAAGGGATATTTGACTATGCAGCAGCTATAGGAGGAGGTACAATCACAGCTGCCCAGTGCCTGATTGACGGGAAGTGTAAAGTAGCCATTAACTGGTCTGGAGGGTGGCATCATGCAAAGAAAGATGAAGCATCTGGTTTCTGTTATCTCAATGATGCTGTCCTAGGAATATTACGATTGCGACGGAAATTTGACCGGATTCTCTATGTGGACTTGGATCTACACCATGGAGATGGTGTAGAAGATGCCTTCAGTTTTACATCTAAAGTTATGACTGTGTCCCTGCACAAGTTCTCTCCAGGATTTTTCCCAGGAACAGGTGACATGTCTGATGTTGGCCTGGGGAAAGGACGGTACTACAGTGTCAATGTGCCCATTCAGGATGGCATCCAGGATGAGAAGTACTATCACATCTGTGAAAGTGTACTAAAGGAAGTATACCAGGCCTTCAATCCGAAGGCAGTGGTTCTACAGCTGGGAGCAGATACCATTGCTGGAGATCCAATGTGCTCCTTTAACATGACACCAGTGGGAATTGGCAAGTGTCTGAAGTATGTCCTTCAGTGGCAGTTGGCAACTCTGATTTTAGGAGGAGGAGGCTACAACCTTGCCAACACGGCTCGTTGCTGGACATACTTGACCGGGGTCATCCTAGGGAAAACACTATCCTCTGAGATCCCAGATCATGAGTTTTTCACAGCATATGGTCCTGATTATGTGCTGGAAATCACGCCAAGCTGCCGGCCAGACCGCAATGAGCCCCATCGAATCCAGCAAATCCTCAACTACATCAAAGGGAATCTGAAGCATGTGGTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T28887-Ab | Anti-HDAC8/ CDA07/ CDLS5 monoclonal antibody |
| Target Antigen | GM-Tg-g-T28887-Ag | HDAC8 VLP (virus-like particle) |
| ORF Viral Vector | pGMAD000844 | Rat Hdac8 Adenovirus plasmid |
| ORF Viral Vector | pGMLP001200 | Human HDAC8 Lentivirus plasmid |
| ORF Viral Vector | vGMAD000844 | Rat Hdac8 Adenovirus particle |
| ORF Viral Vector | vGMLP001200 | Human HDAC8 Lentivirus particle |
Target information
| Target ID | GM-T28887 |
| Target Name | HDAC8 |
| Gene ID | 55869, 70315, 699642, 363481, 101096383, 480957, 540666, 100052401 |
| Gene Symbol and Synonyms | 2610007D20Rik,CDA07,CDLS5,HD8,HDAC8,HDACL1,KDAC8,MRXS6,RGD1562895,RPD3,WTS |
| Uniprot Accession | Q9BY41 |
| Uniprot Entry Name | HDAC8_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000147099 |
| Target Classification | Not Available |
Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene belongs to class I of the histone deacetylase family. It catalyzes the deacetylation of lysine residues in the histone N-terminal tails and represses transcription in large multiprotein complexes with transcriptional co-repressors. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
