Human MMP2/CLG4/CLG4A ORF/cDNA clone-Lentivirus particle (NM_004530.6)
SKU: vGMLV002060
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human MMP2/CLG4/CLG4A Lentiviral expression plasmid for MMP2 lentivirus packaging, MMP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
MMP-2/MMP2/CLG4 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV002060 | Human MMP2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV002060 |
Gene Name | MMP2 |
Accession Number | NM_004530.6 |
Gene ID | 4313 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1983 bp |
Gene Alias | CLG4,CLG4A,MMP-2,MMP-II,MONA,TBE-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGCGCTAATGGCCCGGGGCGCGCTCACGGGTCCCCTGAGGGCGCTCTGTCTCCTGGGCTGCCTGCTGAGCCACGCCGCCGCCGCGCCGTCGCCCATCATCAAGTTCCCCGGCGATGTCGCCCCCAAAACGGACAAAGAGTTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTCCTGGCTCATGCCTTCGCCCCAGGCACTGGTGTTGGGGGAGACTCCCATTTTGATGACGATGAGCTATGGACCTTGGGAGAAGGCCAAGTGGTCCGTGTGAAGTATGGGAACGCCGATGGGGAGTACTGCAAGTTCCCCTTCTTGTTCAATGGCAAGGAGTACAACAGCTGCACTGATACCGGCCGCAGCGATGGCTTCCTCTGGTGCTCCACCACCTACAACTTTGAGAAGGATGGCAAGTACGGCTTCTGTCCCCATGAAGCCCTGTTCACCATGGGCGGCAACGCTGAAGGACAGCCCTGCAAGTTTCCATTCCGCTTCCAGGGCACATCCTATGACAGCTGCACCACTGAGGGCCGCACGGATGGCTACCGCTGGTGCGGCACCACTGAGGACTACGACCGCGACAAGAAGTATGGCTTCTGCCCTGAGACCGCCATGTCCACTGTTGGTGGGAACTCAGAAGGTGCCCCCTGTGTCTTCCCCTTCACTTTCCTGGGCAACAAATATGAGAGCTGCACCAGCGCCGGCCGCAGTGACGGAAAGATGTGGTGTGCGACCACAGCCAACTACGATGATGACCGCAAGTGGGGCTTCTGCCCTGACCAAGGGTACAGCCTGTTCCTCGTGGCAGCCCACGAGTTTGGCCACGCCATGGGGCTGGAGCACTCCCAAGACCCTGGGGCCCTGATGGCACCCATTTACACCTACACCAAGAACTTCCGTCTGTCCCAGGATGACATCAAGGGCATTCAGGAGCTCTATGGGGCCTCTCCTGACATTGACCTTGGCACCGGCCCCACCCCCACGCTGGGCCCTGTCACTCCTGAGATCTGCAAACAGGACATTGTATTTGATGGCATCGCTCAGATCCGTGGTGAGATCTTCTTCTTCAAGGACCGGTTCATTTGGCGGACTGTGACGCCACGTGACAAGCCCATGGGGCCCCTGCTGGTGGCCACATTCTGGCCTGAGCTCCCGGAAAAGATTGATGCGGTATACGAGGCCCCACAGGAGGAGAAGGCTGTGTTCTTTGCAGGGAATGAATACTGGATCTACTCAGCCAGCACCCTGGAGCGAGGGTACCCCAAGCCACTGACCAGCCTGGGACTGCCCCCTGATGTCCAGCGAGTGGATGCCGCCTTTAACTGGAGCAAAAACAAGAAGACATACATCTTTGCTGGAGACAAATTCTGGAGATACAATGAGGTGAAGAAGAAAATGGATCCTGGCTTCCCCAAGCTCATCGCAGATGCCTGGAATGCCATCCCCGATAACCTGGATGCCGTCGTGGACCTGCAGGGCGGCGGTCACAGCTACTTCTTCAAGGGTGCCTATTACCTGAAGCTGGAGAACCAAAGTCTGAAGAGCGTGAAGTTTGGAAGCATCAAATCCGACTGGCTAGGCTGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T68251-Ab | Anti-MMP2/ MMP-2/ CLG4 monoclonal antibody |
Target Antigen | GM-Tg-g-T68251-Ag | MMP-2/MMP2 VLP (virus-like particle) |
ORF Viral Vector | pGMLP001345 | Human MMP2 Lentivirus plasmid |
ORF Viral Vector | pGMLV002060 | Human MMP2 Lentivirus plasmid |
ORF Viral Vector | pGMAP000238 | Human MMP2 Adenovirus plasmid |
ORF Viral Vector | pGMPC001127 | Human MMP2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001345 | Human MMP2 Lentivirus particle |
ORF Viral Vector | vGMLV002060 | Human MMP2 Lentivirus particle |
ORF Viral Vector | vGMAP000238 | Human MMP2 Adenovirus particle |
Target information
Target ID | GM-T68251 |
Target Name | MMP-2 |
Gene ID | 4313, 17390, 698478, 81686, 101098838, 403733, 282872, 100033948 |
Gene Symbol and Synonyms | CLG4,CLG4A,GelA,MMP-2,MMP-II,MMP2,MONA,TBE-1 |
Uniprot Accession | P08253 |
Uniprot Entry Name | MMP2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Ovary Cancer, Neoplasm, Type 1 diabetes mellitus, Vesicoureteral reflux, Alport syndrome, Chronic Kidney Disease, Chronic tubulo-interstitial nephritis, Malignant neoplasm of bladder, Malignant neoplasms of female genital organs |
Gene Ensembl | ENSG00000087245 |
Target Classification | Checkpoint-Immuno Oncology |
This gene is a member of the matrix metalloproteinase (MMP) gene family, that are zinc-dependent enzymes capable of cleaving components of the extracellular matrix and molecules involved in signal transduction. The protein encoded by this gene is a gelatinase A, type IV collagenase, that contains three fibronectin type II repeats in its catalytic site that allow binding of denatured type IV and V collagen and elastin. Unlike most MMP family members, activation of this protein can occur on the cell membrane. This enzyme can be activated extracellularly by proteases, or, intracellulary by its S-glutathiolation with no requirement for proteolytical removal of the pro-domain. This protein is thought to be involved in multiple pathways including roles in the nervous system, endometrial menstrual breakdown, regulation of vascularization, and metastasis. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.