Human MMP2/MMP-II/MONA ORF/cDNA clone-Adenovirus particle (BC002576)

SKU: vGMAP000238
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MMP2/MMP-II/MONA Adenovirus for MMP2 overexpression in-vitro and in-vivo. The MMP2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MMP2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to MMP-2/MMP2/MMP-II products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000238 Human MMP2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000238
Gene Name MMP2
Accession Number BC002576
Gene ID 4313
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1983 bp
Gene Alias MMP-II,MONA,TBE-1
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Kanamycin
Sequence ATGGAGGCGCTAATGGCCCGGGGCGCGCTCACGGGTCCCCTGAGGGCGCTCTGTCTCCTGGGCTGCCTGCTGAGCCACGCCGCCGCCGCGCCGTCGCCCATCATCAAGTTCCCCGGCGATGTCGCCCCCAAAACGGACAAAGAGTTGGCAGTGCAATACCTGAACACCTTCTATGGCTGCCCCAAGGAGAGCTGCAACCTGTTTGTGCTGAAGGACACACTAAAGAAGATGCAGAAGTTCTTTGGACTGCCCCAGACAGGTGATCTTGACCAGAATACCATCGAGACCATGCGGAAGCCACGCTGCGGCAACCCAGATGTGGCCAACTACAACTTCTTCCCTCGCAAGCCCAAGTGGGACAAGAACCAGATCACATACAGGATCATTGGCTACACACCTGATCTGGACCCAGAGACAGTGGATGATGCCTTTGCTCGTGCCTTCCAAGTCTGGAGCGATGTGACCCCACTGCGGTTTTCTCGAATCCATGATGGAGAGGCAGACATCATGATCAACTTTGGCCGCTGGGAGCATGGCGATGGATACCCCTTTGACGGTAAGGACGGACTCCTGGCTCATGCCTTCGCCCCAGGCACTGGTGTTGGGGGAGACTCCCATTTTGATGACGATGAGCTATGGACCTTGGGAGAAGGCCAAGTGGTCCGTGTGAAGTATGGCAACGCCGATGGGGAGTACTGCAAGTTCCCCTTCTTGTTCAATGGCAAGGAGTACAACAGCTGCACTGATACCGGCCGCAGCGATGGCTTCCTCTGGTGCTCCACCACCTACAACTTTGAGAAGGATGGCAAGTACGGCTTCTGTCCCCATGAAGCCCTGTTCACCATGGGCGGCAACGCTGAAGGACAGCCCTGCAAGTTTCCATTCCGCTTCCAGGGCACATCCTATGACAGCTGCACCACTGAGGGCCGCACGGATGGCTACCGCTGGTGCGGCACCACTGAGGACTACGACCGCGACAAGAAGTATGGCTTCTGCCCTGAGACCGCCATGTCCACTGTTGGTGGGAACTCAGAAGGTGCCCCCTGTGTCTTCCCCTTCACTTTCCTGGGCAACAAATATGAGAGCTGCACCAGCGCCGGCCGCAGTGACGGAAAGATGTGGTGTGCGACCACAGCCAACTACGATGACGACCGCAAGTGGGGCTTCTGCCCTGACCAAGGGTACAGCCTGTTCCTCGTGGCAGCCCACGAGTTTGGCCACGCCATGGGGCTGGAGCACTCCCAAGACCCTGGGGCCCTGATGGCACCCATTTACACCTACACCAAGAACTTCCGTCTGTCCCAGGATGACATCAAGGGCATTCAGGAGCTCTATGGGGCCTCTCCTGACATTGACCTTGGCACCGGCCCCACCCCCACACTGGGCCCTGTCACTCCTGAGATCTGCAAACAGGACATTGTATTTGATGGCATCGCTCAGATCCGTGGTGAGATCTTCTTCTTCAAGGACCGGTTCATTTGGCGGACTGTGACGCCACGTGACAAGCCCATGGGGCCCCTGCTGGTGGCCACATTCTGGCCTGAGCTCCCGGAAAAGATTGATGCGGTATACGAGGCCCCACAGGAGGAGAAGGCTGTGTTCTTTGCAGGGAATGAATACTGGATCTACTCAGCCAGCACCCTGGAGCGAGGGTACCCCAAGCCACTGACCAGCCTGGGACTGCCCCCTGATGTCCAGCGAGTGGATGCCGCCTTTAACTGGAGCAAAAACAAGAAGACATACATCTTTGCTGGAGACAAATTCTGGAGATACAATGAGGTGAAGAAGAAAATGGATCCTGGCTTTCCCAAGCTCATCGCAGATGCCTGGAATGCCATCCCCGATAACCTGGATGCCGTCGTGGACCTGCAGGGCGGCGGTCACAGCTACTTCTTCAAGGGTGCCTATTACCTGAAGCTGGAGAACCAAAGTCTGAAGAGCGTGAAGTTTGGAAGCATCAAATCCGACTGGCTAGGCTGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68251-Ab Anti-MMP2/ MMP-2/ CLG4 monoclonal antibody
    Target Antigen GM-Tg-g-T68251-Ag MMP-2/MMP2 VLP (virus-like particle)
    ORF Viral Vector pGMLP001345 Human MMP2 Lentivirus plasmid
    ORF Viral Vector pGMLV002060 Human MMP2 Lentivirus plasmid
    ORF Viral Vector pGMAP000238 Human MMP2 Adenovirus plasmid
    ORF Viral Vector pGMPC001127 Human MMP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001345 Human MMP2 Lentivirus particle
    ORF Viral Vector vGMLV002060 Human MMP2 Lentivirus particle
    ORF Viral Vector vGMAP000238 Human MMP2 Adenovirus particle


    Target information

    Target ID GM-T68251
    Target Name MMP-2
    Gene ID 4313, 17390, 698478, 81686, 101098838, 403733, 282872, 100033948
    Gene Symbol and Synonyms CLG4,CLG4A,GelA,MMP-2,MMP-II,MMP2,MONA,TBE-1
    Uniprot Accession P08253
    Uniprot Entry Name MMP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Ovary Cancer, Neoplasm, Type 1 diabetes mellitus, Vesicoureteral reflux, Alport syndrome, Chronic Kidney Disease, Chronic tubulo-interstitial nephritis, Malignant neoplasm of bladder, Malignant neoplasms of female genital organs
    Gene Ensembl ENSG00000087245
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the matrix metalloproteinase (MMP) gene family, that are zinc-dependent enzymes capable of cleaving components of the extracellular matrix and molecules involved in signal transduction. The protein encoded by this gene is a gelatinase A, type IV collagenase, that contains three fibronectin type II repeats in its catalytic site that allow binding of denatured type IV and V collagen and elastin. Unlike most MMP family members, activation of this protein can occur on the cell membrane. This enzyme can be activated extracellularly by proteases, or, intracellulary by its S-glutathiolation with no requirement for proteolytical removal of the pro-domain. This protein is thought to be involved in multiple pathways including roles in the nervous system, endometrial menstrual breakdown, regulation of vascularization, and metastasis. Mutations in this gene have been associated with Winchester syndrome and Nodulosis-Arthropathy-Osteolysis (NAO) syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.