Human SLC10A1/FHCA2/ NTCP ORF/cDNA clone-Lentivirus particle (NM_003049)
Pre-made Human SLC10A1/FHCA2/ NTCP Lentiviral expression plasmid for SLC10A1 lentivirus packaging, SLC10A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to SLC10A1/FHCA2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001757 | Human SLC10A1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001757 |
Gene Name | SLC10A1 |
Accession Number | NM_003049 |
Gene ID | 6554 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1050 bp |
Gene Alias | FHCA2, NTCP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACTTTGGCAAGCGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCATCATGCTCTCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGCCTAAAGGGCTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTGTGCTGGGCAAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCTGCTCACCTGGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACCTCAGCATTGTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCCTGTACATCTACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAGGCATCGTGATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAATCCAAACGGCCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGTGCAGTGTGGCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCATGACACCACTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTTATGTTCTCTCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGACTGGATGCCAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAGTCATTGGACCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGCTTCTCCTCATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAAAAATGATCTACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCACCTACAAAGGGGAGGACTGCTCCCCTTGCACAGCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T99189-Ab | Anti-NTCP/ SLC10A1 monoclonal antibody |
Target Antigen | GM-Tg-g-T99189-Ag | SLC10A1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000268 | Human SLC10A1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000922 | Human SLC10A1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001757 | Human SLC10A1 Lentivirus plasmid |
ORF Viral Vector | pGMPC000986 | Human SLC10A1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000375 | Human SLC10A1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000268 | Human SLC10A1 Lentivirus particle |
ORF Viral Vector | vGMLV000922 | Human SLC10A1 Lentivirus particle |
ORF Viral Vector | vGMLV001757 | Human SLC10A1 Lentivirus particle |
ORF Viral Vector | vGMAP000375 | Human SLC10A1 Adenovirus particle |
ORF Viral Vector | pGMLV002355 | Human SLC10A1 Lentivirus plasmid |
Target information
Target ID | GM-T99189 |
Target Name | SLC10A1 |
Gene ID | 6554, 20493, 712925, 24777, 101080544, 480372, 532890, 100064290 |
Gene Symbol and Synonyms | FHCA2,NTCP,Ntcp1,SBACT,SLC10A1 |
Uniprot Accession | Q14973 |
Uniprot Entry Name | NTCP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000100652 |
Target Classification | Not Available |
The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.