Human SLC10A1/NTCP ORF/cDNA clone-Lentivirus plasmid (NM_003049.4)

Pre-made Human SLC10A1/NTCP Lentiviral expression plasmid for SLC10A1 lentivirus packaging, SLC10A1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SLC10A1/NTCP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000922 Human SLC10A1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000922
Gene Name SLC10A1
Accession Number NM_003049.4
Gene ID 6554
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1050 bp
Gene Alias NTCP
Fluorescent Reporter
Mammalian Cell Selection Neomycin/G418
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGAGGCCCACAACGCGTCTGCCCCATTCAACTTCACCCTGCCACCCAACTTTGGCAAGCGCCCCACAGACCTGGCACTGAGCGTCATCCTGGTGTTCATGTTGTTCTTCATCATGCTCTCGCTGGGCTGCACCATGGAGTTCAGCAAGATCAAGGCTCACTTATGGAAGCCTAAAGGGCTGGCCATCGCCCTGGTGGCACAGTATGGCATCATGCCCCTCACGGCCTTTGTGCTGGGCAAGGTCTTCCGGCTGAAGAACATTGAGGCACTGGCCATCTTGGTCTGTGGCTGCTCACCTGGAGGGAACCTGTCCAATGTCTTCAGTCTGGCCATGAAGGGGGACATGAACCTCAGCATTGTGATGACCACCTGCTCCACCTTCTGTGCCCTTGGCATGATGCCTCTCCTCCTGTACATCTACTCCAGGGGGATCTATGATGGGGACCTGAAGGACAAGGTGCCCTATAAAGGCATCGTGATATCACTGGTCCTGGTTCTCATTCCTTGCACCATAGGGATCGTCCTCAAATCCAAACGGCCACAATACATGCGCTATGTCATCAAGGGAGGGATGATCATCATTCTCTTGTGCAGTGTGGCCGTCACAGTTCTCTCTGCCATCAATGTGGGGAAGAGCATCATGTTTGCCATGACACCACTCTTGATTGCCACCTCCTCCCTGATGCCTTTTATTGGCTTTCTGCTGGGTTATGTTCTCTCTGCTCTCTTCTGCCTCAATGGACGGTGCAGACGCACTGTCAGCATGGAGACTGGATGCCAAAATGTCCAACTCTGTTCCACCATCCTCAATGTGGCCTTTCCACCTGAAGTCATTGGACCACTTTTCTTCTTTCCCCTCCTCTACATGATTTTCCAGCTTGGAGAAGGGCTTCTCCTCATTGCCATATTTTGGTGCTATGAGAAATTCAAGACTCCCAAGGATAAAACAAAAATGATCTACACAGCTGCCACAACTGAAGAAACAATTCCAGGAGCTCTGGGAAATGGCACCTACAAAGGGGAGGACTGCTCCCCTTGCACAGCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T99189-Ab Anti-NTCP/ SLC10A1 monoclonal antibody
    Target Antigen GM-Tg-g-T99189-Ag SLC10A1 VLP (virus-like particle)
    ORF Viral Vector pGMLV000268 Human SLC10A1 Lentivirus plasmid
    ORF Viral Vector pGMLV000922 Human SLC10A1 Lentivirus plasmid
    ORF Viral Vector pGMLV001757 Human SLC10A1 Lentivirus plasmid
    ORF Viral Vector pGMPC000986 Human SLC10A1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000375 Human SLC10A1 Adenovirus plasmid
    ORF Viral Vector vGMLV000268 Human SLC10A1 Lentivirus particle
    ORF Viral Vector vGMLV000922 Human SLC10A1 Lentivirus particle
    ORF Viral Vector vGMLV001757 Human SLC10A1 Lentivirus particle
    ORF Viral Vector vGMAP000375 Human SLC10A1 Adenovirus particle
    ORF Viral Vector pGMLV002355 Human SLC10A1 Lentivirus plasmid


    Target information

    Target ID GM-T99189
    Target Name SLC10A1
    Gene ID 6554, 20493, 712925, 24777, 101080544, 480372, 532890, 100064290
    Gene Symbol and Synonyms FHCA2,NTCP,Ntcp1,SBACT,SLC10A1
    Uniprot Accession Q14973
    Uniprot Entry Name NTCP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100652
    Target Classification Not Available

    The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.