Human ST8SIA1/GD3S/ SIAT8 ORF/cDNA clone-Lentivirus particle (NM_003034)
Pre-made Human ST8SIA1/GD3S/ SIAT8 Lentiviral expression plasmid for ST8SIA1 lentivirus packaging, ST8SIA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to ST8SIA1/GD3S products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP003149 | Human ST8SIA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP003149 |
Gene Name | ST8SIA1 |
Accession Number | NM_003034 |
Gene ID | 6489 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1071 bp |
Gene Alias | GD3S, SIAT8, SIAT8-A, SIAT8A, ST8SiaI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGCCCCTGCGGGCGGGCCCGGCGACAAACGTCCAGAGGGGCCATGGCTGTACTGGCGTGGAAGTTCCCGCGGACCCGGCTGCCCATGGGAGCCAGTGCCCTCTGTGTCGTGGTCCTCTGTTGGCTCTACATCTTCCCCGTCTACCGGCTGCCCAACGAGAAAGAGATCGTGCAGGGGGTGCTGCAACAGGGCACGGCGTGGAGGAGGAACCAGACCGCGGCCAGAGCGTTCAGGAAACAAATGGAAGACTGCTGCGACCCTGCCCATCTCTTTGCTATGACTAAAATGAATTCCCCTATGGGGAAGAGCATGTGGTATGACGGGGAGTTTTTATACTCATTCACCATTGACAATTCAACTTACTCTCTCTTCCCACAGGCAACCCCATTCCAGCTGCCATTGAAGAAATGCGCGGTGGTGGGAAATGGTGGGATTCTGAAGAAGAGTGGCTGTGGCCGTCAAATAGATGAAGCAAATTTTGTCATGCGATGCAATCTCCCTCCTTTGTCAAGTGAATACACTAAGGATGTTGGATCCAAAAGTCAGTTAGTGACAGCTAATCCCAGCATAATTCGGCAAAGGTTTCAGAACCTTCTGTGGTCCAGAAAGACATTTGTGGACAACATGAAAATTTATAACCACAGTTACATCTACATGCCTGCCTTTTCTATGAAGACAGGAACAGAGCCATCTTTGAGGGTTTATTATACACTGTCAGATGTTGGTGCCAATCAAACAGTGCTGTTTGCCAACCCCAACTTTCTGCGTAGCATTGGAAAGTTCTGGAAAAGTAGAGGAATCCATGCCAAGCGCCTGTCCACAGGACTTTTTCTGGTGAGCGCAGCTCTGGGTCTCTGTGAAGAGGTGGCCATCTATGGCTTCTGGCCCTTCTCTGTGAATATGCATGAGCAGCCCATCAGCCACCACTACTATGACAACGTCTTACCCTTTTCTGGCTTCCATGCCATGCCCGAGGAATTTCTCCAACTCTGGTATCTTCATAAAATCGGTGCACTGAGAATGCAGCTGGACCCATGTGAAGATACCTCACTCCAGCCCACTTCCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1835-Ab | Anti-ST8SIA1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1835-Ag | ST8SIA1 protein |
ORF Viral Vector | pGMLV000269 | Human ST8SIA1 Lentivirus plasmid |
ORF Viral Vector | pGMLP001344 | Human ST8SIA1 Lentivirus plasmid |
ORF Viral Vector | pGMLP003149 | Human ST8SIA1 Lentivirus plasmid |
ORF Viral Vector | vGMLV000269 | Human ST8SIA1 Lentivirus particle |
ORF Viral Vector | vGMLP001344 | Human ST8SIA1 Lentivirus particle |
ORF Viral Vector | vGMLP003149 | Human ST8SIA1 Lentivirus particle |
Target information
Target ID | GM-IP1835 |
Target Name | ST8SIA1 |
Gene ID | 6489, 20449, 706707, 25280, 101093029, 477672, 282352 |
Gene Symbol and Synonyms | 9330109E03Rik,GD3S,Sia-T,SIAT8,SIAT8-A,SIAT8A,ST8SIA1,ST8SiaI |
Uniprot Accession | Q92185 |
Uniprot Entry Name | SIA8A_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000111728 |
Target Classification | Not Available |
Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.