Human ST8SIA1/GD3S/ SIAT8 ORF/cDNA clone-Lentivirus plasmid (NM_003034)

Pre-made Human ST8SIA1/GD3S/ SIAT8 Lentiviral expression plasmid for ST8SIA1 lentivirus packaging, ST8SIA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ST8SIA1/GD3S products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP001344 Human ST8SIA1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP001344
Gene Name ST8SIA1
Accession Number NM_003034
Gene ID 6489
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1071 bp
Gene Alias GD3S, SIAT8, SIAT8-A, SIAT8A, ST8SiaI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGCCCCTGCGGGCGGGCCCGGCGACAAACGTCCAGAGGGGCCATGGCTGTACTGGCGTGGAAGTTCCCGCGGACCCGGCTGCCCATGGGAGCCAGTGCCCTCTGTGTCGTGGTCCTCTGTTGGCTCTACATCTTCCCCGTCTACCGGCTGCCCAACGAGAAAGAGATCGTGCAGGGGGTGCTGCAACAGGGCACGGCGTGGAGGAGGAACCAGACCGCGGCCAGAGCGTTCAGGAAACAAATGGAAGACTGCTGCGACCCTGCCCATCTCTTTGCTATGACTAAAATGAATTCCCCTATGGGGAAGAGCATGTGGTATGACGGGGAGTTTTTATACTCATTCACCATTGACAATTCAACTTACTCTCTCTTCCCACAGGCAACCCCATTCCAGCTGCCATTGAAGAAATGCGCGGTGGTGGGAAATGGTGGGATTCTGAAGAAGAGTGGCTGTGGCCGTCAAATAGATGAAGCAAATTTTGTCATGCGATGCAATCTCCCTCCTTTGTCAAGTGAATACACTAAGGATGTTGGATCCAAAAGTCAGTTAGTGACAGCTAATCCCAGCATAATTCGGCAAAGGTTTCAGAACCTTCTGTGGTCCAGAAAGACATTTGTGGACAACATGAAAATTTATAACCACAGTTACATCTACATGCCTGCCTTTTCTATGAAGACAGGAACAGAGCCATCTTTGAGGGTTTATTATACACTGTCAGATGTTGGTGCCAATCAAACAGTGCTGTTTGCCAACCCCAACTTTCTGCGTAGCATTGGAAAGTTCTGGAAAAGTAGAGGAATCCATGCCAAGCGCCTGTCCACAGGACTTTTTCTGGTGAGCGCAGCTCTGGGTCTCTGTGAAGAGGTGGCCATCTATGGCTTCTGGCCCTTCTCTGTGAATATGCATGAGCAGCCCATCAGCCACCACTACTATGACAACGTCTTACCCTTTTCTGGCTTCCATGCCATGCCCGAGGAATTTCTCCAACTCTGGTATCTTCATAAAATCGGTGCACTGAGAATGCAGCTGGACCCATGTGAAGATACCTCACTCCAGCCCACTTCCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1835-Ab Anti-ST8SIA1 monoclonal antibody
    Target Antigen GM-Tg-g-IP1835-Ag ST8SIA1 protein
    ORF Viral Vector pGMLV000269 Human ST8SIA1 Lentivirus plasmid
    ORF Viral Vector pGMLP001344 Human ST8SIA1 Lentivirus plasmid
    ORF Viral Vector pGMLP003149 Human ST8SIA1 Lentivirus plasmid
    ORF Viral Vector vGMLV000269 Human ST8SIA1 Lentivirus particle
    ORF Viral Vector vGMLP001344 Human ST8SIA1 Lentivirus particle
    ORF Viral Vector vGMLP003149 Human ST8SIA1 Lentivirus particle


    Target information

    Target ID GM-IP1835
    Target Name ST8SIA1
    Gene ID 6489, 20449, 706707, 25280, 101093029, 477672, 282352
    Gene Symbol and Synonyms 9330109E03Rik,GD3S,Sia-T,SIAT8,SIAT8-A,SIAT8A,ST8SIA1,ST8SiaI
    Uniprot Accession Q92185
    Uniprot Entry Name SIA8A_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000111728
    Target Classification Not Available

    Gangliosides are membrane-bound glycosphingolipids containing sialic acid. Ganglioside GD3 is known to be important for cell adhesion and growth of cultured malignant cells. The protein encoded by this gene is a type II membrane protein that catalyzes the transfer of sialic acid from CMP-sialic acid to GM3 to produce gangliosides GD3 and GT3. The encoded protein may be found in the Golgi apparatus and is a member of glycosyltransferase family 29. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.