Human SPRY2/hSPRY2/IGAN3 ORF/cDNA clone-Lentivirus particle (NM_005842)

Cat. No.: vGMLP000306

Pre-made Human SPRY2/hSPRY2/IGAN3 Lentiviral expression plasmid for SPRY2 lentivirus packaging, SPRY2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to SPRY2/hSPRY2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000306 Human SPRY2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000306
Gene Name SPRY2
Accession Number NM_005842
Gene ID 10253
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 948 bp
Gene Alias hSPRY2,IGAN3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCCAGAGCTCAGAGTGGCAACGGGTCGCAGCCCTTGCTGCAGACGCCCCGTGACGGTGGCAGACAGCGTGGGGAGCCCGACCCCAGAGACGCCCTCACCCAGCAGGTACATGTCTTGTCTCTGGATCAGATCAGAGCCATCCGAAACACCAATGAGTACACAGAGGGGCCTACTGTCGTCCCAAGACCTGGGCTCAAGCCTGCTCCTCGCCCCTCCACTCAGCACAAACACGAGAGACTCCACGGTCTGCCTGAGCACCGCCAGCCTCCTAGGCTCCAGCACTCGCAGGTCCATTCTTCTGCACGAGCCCCTCTGTCCAGATCCATAAGCACGGTCAGCTCAGGGTCGCGGAGCAGTACGAGGACAAGTACCAGCAGCAGCTCCTCTGAACAGAGACTGCTAGGATCATCCTTCTCCTCCGGGCCTGTTGCTGATGGCATAATCCGGGTGCAACCCAAATCTGAGCTCAAGCCAGGTGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTCAAACACAGTTTGCTGCAAAGTTCCCACTGTCCCCCCTAGGAACTTTGAAAAACCAACATAG
ORF Protein Sequence MEARAQSGNGSQPLLQTPRDGGRQRGEPDPRDALTQQVHVLSLDQIRAIRNTNEYTEGPTVVPRPGLKPAPRPSTQHKHERLHGLPEHRQPPRLQHSQVHSSARAPLSRSISTVSSGSRSSTRTSTSSSSSEQRLLGSSFSSGPVADGIIRVQPKSELKPGELKPLSKEDLGLHAYRCEDCGKCKCKECTYPRPLPSDWICDKQCLCSAQNVIDYGTCVCCVKGLFYHCSNDDEDNCADNPCSCSQSHCCTRWSAMGVMSLFLPCLWCYLPAKGCLKLCQGCYDRVNRPGCRCKNSNTVCCKVPTVPPRNFEKPT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1709-Ab Anti-SPY2/ SPRY2/ IGAN3 monoclonal antibody
    Target Antigen GM-Tg-g-MP1709-Ag SPRY2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1709 sprouty homolog 2 (Drosophila) (SPRY2) protein & antibody
    ORF Viral Vector pGMLP000306 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMLP005719 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMAD000520 Human SPRY2 Adenovirus plasmid
    ORF Viral Vector vGMLP000306 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMLP005719 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMAD000520 Human SPRY2 Adenovirus particle


    Target information

    Target ID GM-MP1709
    Target Name SPRY2
    Gene ID 10253, 24064, 702103, 306141, 101088453, 485504, 539090, 100050086
    Gene Symbol and Synonyms hSPRY2,IGAN3,sprouty2,SPRY2
    Uniprot Accession O43597
    Uniprot Entry Name SPY2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000136158
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.