Human SPRY2/hSPRY2/IGAN3 ORF/cDNA clone-Adenovirus plasmid (NM_005842.4)

Cat. No.: pGMAD000520
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SPRY2/hSPRY2/IGAN3 adenoviral expression plasmid for SPRY2 adenovirus packaging, SPRY2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to SPRY2/hSPRY2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAD000520
Gene Name SPRY2
Accession Number NM_005842.4
Gene ID 10253
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 948 bp
Gene Alias hSPRY2,IGAN3
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGAGGCCAGAGCTCAGAGTGGCAACGGGTCGCAGCCCTTGCTGCAGACGCCCCGTGACGGTGGCAGACAGCGTGGGGAGCCCGACCCCAGAGACGCCCTCACCCAGCAGGTACATGTCTTGTCTCTGGATCAGATCAGAGCCATCCGAAACACCAATGAGTACACAGAGGGGCCTACTGTCGTCCCAAGACCTGGGCTCAAGCCTGCTCCTCGCCCCTCCACTCAGCACAAACACGAGAGACTCCACGGTCTGCCTGAGCACCGCCAGCCTCCTAGGCTCCAGCACTCGCAGGTCCATTCTTCTGCACGAGCCCCTCTGTCCAGATCCATAAGCACGGTCAGCTCAGGGTCGCGGAGCAGTACGAGGACAAGTACCAGCAGCAGCTCCTCTGAACAGAGACTGCTAGGATCATCCTTCTCCTCCGGGCCTGTTGCTGATGGCATAATCCGGGTGCAACCCAAATCTGAGCTCAAGCCAGGTGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTCAAACACAGTTTGCTGCAAAGTTCCCACTGTCCCCCCTAGGAACTTTGAAAAACCAACATAG
ORF Protein Sequence MEARAQSGNGSQPLLQTPRDGGRQRGEPDPRDALTQQVHVLSLDQIRAIRNTNEYTEGPTVVPRPGLKPAPRPSTQHKHERLHGLPEHRQPPRLQHSQVHSSARAPLSRSISTVSSGSRSSTRTSTSSSSSEQRLLGSSFSSGPVADGIIRVQPKSELKPGELKPLSKEDLGLHAYRCEDCGKCKCKECTYPRPLPSDWICDKQCLCSAQNVIDYGTCVCCVKGLFYHCSNDDEDNCADNPCSCSQSHCCTRWSAMGVMSLFLPCLWCYLPAKGCLKLCQGCYDRVNRPGCRCKNSNTVCCKVPTVPPRNFEKPT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1709-Ab Anti-SPY2/ SPRY2/ IGAN3 monoclonal antibody
    Target Antigen GM-Tg-g-MP1709-Ag SPRY2 VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-MP1709 sprouty homolog 2 (Drosophila) (SPRY2) protein & antibody
    ORF Viral Vector pGMLP000306 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMLP005719 Human SPRY2 Lentivirus plasmid
    ORF Viral Vector pGMAD000520 Human SPRY2 Adenovirus plasmid
    ORF Viral Vector vGMLP000306 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMLP005719 Human SPRY2 Lentivirus particle
    ORF Viral Vector vGMAD000520 Human SPRY2 Adenovirus particle


    Target information

    Target ID GM-MP1709
    Target Name SPRY2
    Gene ID 10253, 24064, 702103, 306141, 101088453, 485504, 539090, 100050086
    Gene Symbol and Synonyms hSPRY2,IGAN3,sprouty2,SPRY2
    Uniprot Accession O43597
    Uniprot Entry Name SPY2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000136158
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.