Human SPRY2/hSPRY2/IGAN3 ORF/cDNA clone-Lentivirus plasmid (NM_001318536.1)
Cat. No.: pGMLP005719
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SPRY2/hSPRY2/IGAN3 Lentiviral expression plasmid for SPRY2 lentivirus packaging, SPRY2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SPRY2/hSPRY2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP005719 |
Gene Name | SPRY2 |
Accession Number | NM_001318536.1 |
Gene ID | 10253 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 948 bp |
Gene Alias | hSPRY2,IGAN3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGAGGCCAGAGCTCAGAGTGGCAACGGGTCGCAGCCCTTGCTGCAGACGCCCCGTGACGGTGGCAGACAGCGTGGGGAGCCCGACCCCAGAGACGCCCTCACCCAGCAGGTACATGTCTTGTCTCTGGATCAGATCAGAGCCATCCGAAACACCAATGAGTACACAGAGGGGCCTACTGTCGTCCCAAGACCTGGGCTCAAGCCTGCTCCTCGCCCCTCCACTCAGCACAAACACGAGAGACTCCACGGTCTGCCTGAGCACCGCCAGCCTCCTAGGCTCCAGCACTCGCAGGTCCATTCTTCTGCACGAGCCCCTCTGTCCAGATCCATAAGCACGGTCAGCTCAGGGTCGCGGAGCAGTACGAGGACAAGTACCAGCAGCAGCTCCTCTGAACAGAGACTGCTAGGATCATCCTTCTCCTCCGGGCCTGTTGCTGATGGCATAATCCGGGTGCAACCCAAATCTGAGCTCAAGCCAGGTGAGCTTAAGCCACTGAGCAAGGAAGATTTGGGCCTGCACGCCTACAGGTGTGAGGACTGTGGCAAGTGCAAATGTAAGGAGTGCACCTACCCAAGGCCTCTGCCATCAGACTGGATCTGCGACAAGCAGTGCCTTTGCTCGGCCCAGAACGTGATTGACTATGGGACTTGTGTATGCTGTGTGAAAGGTCTCTTCTATCACTGTTCTAATGATGATGAGGACAACTGTGCTGACAACCCATGTTCTTGCAGCCAGTCTCACTGTTGTACACGATGGTCAGCCATGGGTGTCATGTCCCTCTTTTTGCCTTGTTTATGGTGTTACCTTCCAGCCAAGGGTTGCCTTAAATTGTGCCAGGGGTGTTATGACCGGGTTAACAGGCCTGGTTGCCGCTGTAAAAACTCAAACACAGTTTGCTGCAAAGTTCCCACTGTCCCCCCTAGGAACTTTGAAAAACCAACATAG |
ORF Protein Sequence | MEARAQSGNGSQPLLQTPRDGGRQRGEPDPRDALTQQVHVLSLDQIRAIRNTNEYTEGPTVVPRPGLKPAPRPSTQHKHERLHGLPEHRQPPRLQHSQVHSSARAPLSRSISTVSSGSRSSTRTSTSSSSSEQRLLGSSFSSGPVADGIIRVQPKSELKPGELKPLSKEDLGLHAYRCEDCGKCKCKECTYPRPLPSDWICDKQCLCSAQNVIDYGTCVCCVKGLFYHCSNDDEDNCADNPCSCSQSHCCTRWSAMGVMSLFLPCLWCYLPAKGCLKLCQGCYDRVNRPGCRCKNSNTVCCKVPTVPPRNFEKPT |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP1709-Ab | Anti-SPY2/ SPRY2/ IGAN3 monoclonal antibody |
Target Antigen | GM-Tg-g-MP1709-Ag | SPRY2 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-MP1709 | sprouty homolog 2 (Drosophila) (SPRY2) protein & antibody |
ORF Viral Vector | pGMLP000306 | Human SPRY2 Lentivirus plasmid |
ORF Viral Vector | pGMLP005719 | Human SPRY2 Lentivirus plasmid |
ORF Viral Vector | pGMAD000520 | Human SPRY2 Adenovirus plasmid |
ORF Viral Vector | vGMLP000306 | Human SPRY2 Lentivirus particle |
ORF Viral Vector | vGMLP005719 | Human SPRY2 Lentivirus particle |
ORF Viral Vector | vGMAD000520 | Human SPRY2 Adenovirus particle |
Target information
Target ID | GM-MP1709 |
Target Name | SPRY2 |
Gene ID | 10253, 24064, 702103, 306141, 101088453, 485504, 539090, 100050086 |
Gene Symbol and Synonyms | hSPRY2,IGAN3,sprouty2,SPRY2 |
Uniprot Accession | O43597 |
Uniprot Entry Name | SPY2_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000136158 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein belonging to the sprouty family. The encoded protein contains a carboxyl-terminal cysteine-rich domain essential for the inhibitory activity on receptor tyrosine kinase signaling proteins and is required for growth factor stimulated translocation of the protein to membrane ruffles. In primary dermal endothelial cells this gene is transiently upregulated in response to fibroblast growth factor two. This protein is indirectly involved in the non-cell autonomous inhibitory effect on fibroblast growth factor two signaling. The protein interacts with Cas-Br-M (murine) ectropic retroviral transforming sequence, and can function as a bimodal regulator of epidermal growth factor receptor/mitogen-activated protein kinase signaling. This protein may play a role in alveoli branching during lung development as shown by a similar mouse protein. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.