Human TGFB3/ARVD/ ARVD1 ORF/cDNA clone-Lentivirus particle (NM_003239)
Pre-made Human TGFB3/ARVD/ ARVD1 Lentiviral expression plasmid for TGFB3 lentivirus packaging, TGFB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to TGFB3/ARVD products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP-SPh-039 | Human TGFB3 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP-SPh-039 |
Gene Name | TGFB3 |
Accession Number | NM_003239 |
Gene ID | 7043 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1239 bp |
Gene Alias | ARVD, ARVD1, LDS5, RNHF, TGF-beta3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGATGCACTTGCAAAGGGCTCTGGTGGTCCTGGCCCTGCTGAACTTTGCCACGGTCAGCCTCTCTCTGTCCACTTGCACCACCTTGGACTTCGGCCACATCAAGAAGAAGAGGGTGGAAGCCATTAGGGGACAGATCTTGAGCAAGCTCAGGCTCACCAGCCCCCCTGAGCCAACGGTGATGACCCACGTCCCCTATCAGGTCCTGGCCCTTTACAACAGCACCCGGGAGCTGCTGGAGGAGATGCATGGGGAGAGGGAGGAAGGCTGCACCCAGGAAAACACCGAGTCGGAATACTATGCCAAAGAAATCCATAAATTCGACATGATCCAGGGGCTGGCGGAGCACAACGAACTGGCTGTCTGCCCTAAAGGAATTACCTCCAAGGTTTTCCGCTTCAATGTGTCCTCAGTGGAGAAAAATAGAACCAACCTATTCCGAGCAGAATTCCGGGTCTTGCGGGTGCCCAACCCCAGCTCTAAGCGGAATGAGCAGAGGATCGAGCTCTTCCAGATCCTTCGGCCAGATGAGCACATTGCCAAACAGCGCTATATCGGTGGCAAGAATCTGCCCACACGGGGCACTGCCGAGTGGCTGTCCTTTGATGTCACTGACACTGTGCGTGAGTGGCTGTTGAGAAGAGAGTCCAACTTAGGTCTAGAAATCAGCATTCACTGTCCATGTCACACCTTTCAGCCCAATGGAGATATCCTGGAAAACATTCACGAGGTGATGGAAATCAAATTCAAAGGCGTGGACAATGAGGATGACCATGGCCGTGGAGATCTGGGGCGCCTCAAGAAGCAGAAGGATCACCACAACCCTCATCTAATCCTCATGATGATTCCCCCACACCGGCTCGACAACCCGGGCCAGGGGGGTCAGAGGAAGAAGCGGGCTTTGGACACCAATTACTGCTTCCGCAACTTGGAGGAGAACTGCTGTGTGCGCCCCCTCTACATTGACTTCCGACAGGATCTGGGCTGGAAGTGGGTCCATGAACCTAAGGGCTACTATGCCAACTTCTGCTCAGGCCCTTGCCCATACCTCCGCAGTGCAGACACAACCCACAGCACGGTGCTGGGACTGTACAACACTCTGAACCCTGAAGCATCTGCCTCGCCTTGCTGCGTGCCCCAGGACCTGGAGCCCCTGACCATCCTGTACTATGTTGGGAGGACCCCCAAAGTGGAGCAGCTCTCCAACATGGTGGTGAAGTCTTGTAAATGTAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T22978-Ab | Anti-TGFB3/ ARVD/ ARVD1 monoclonal antibody |
Target Antigen | GM-Tg-g-T22978-Ag | TGFB3 VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T22978 | transforming growth factor, beta 3 (TGFB3) protein & antibody |
ORF Viral Vector | pGMLP003661 | Human TGFB3 Lentivirus plasmid |
ORF Viral Vector | pGMLP-SPh-039 | Human TGFB3 Lentivirus plasmid |
ORF Viral Vector | pGMAP-SPh-179 | Human TGFB3 Adenovirus plasmid |
ORF Viral Vector | vGMLP003661 | Human TGFB3 Lentivirus particle |
ORF Viral Vector | vGMLP-SPh-039 | Human TGFB3 Lentivirus particle |
ORF Viral Vector | vGMAP-SPh-179 | Human TGFB3 Adenovirus particle |
Target information
Target ID | GM-T22978 |
Target Name | TGFB3 |
Gene ID | 7043, 21809, 703239, 25717, 101098469, 490796, 538957, 100051765 |
Gene Symbol and Synonyms | ARVD,ARVD1,LDS5,RNHF,TGF-B3,TGF-beta-3,TGF-beta3,Tgfb-3,TGFB3,TGFbeta3 |
Uniprot Accession | P10600 |
Uniprot Entry Name | TGFB3_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000119699 |
Target Classification | Checkpoint-Immuno Oncology |
This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. This protein is involved in embryogenesis and cell differentiation, and may play a role in wound healing. Mutations in this gene are a cause of aortic aneurysms and dissections, as well as familial arrhythmogenic right ventricular dysplasia 1. [provided by RefSeq, Aug 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.