Human PCNA/MGC8367 ORF/cDNA clone-Adenovirus particle (BC000491)
Pre-made Human PCNA/MGC8367 Adenovirus for PCNA overexpression in-vitro and in-vivo. The PCNA adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PCNA-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to PCNA/MGC8367 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000111 | Human PCNA Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000111 |
Gene Name | PCNA |
Accession Number | BC000491 |
Gene ID | 5111 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 786 bp |
Gene Alias | MGC8367 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAGGACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATGGACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTACCGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGATCTTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T21782-Ab | Anti-PCNA monoclonal antibody |
Target Antigen | GM-Tg-g-T21782-Ag | PCNA protein |
ORF Viral Vector | pGMLV000281 | Human PCNA Lentivirus plasmid |
ORF Viral Vector | pGMLV000502 | Human PCNA Lentivirus plasmid |
ORF Viral Vector | pGMAP000111 | Human PCNA Adenovirus plasmid |
ORF Viral Vector | vGMLV000281 | Human PCNA Lentivirus particle |
ORF Viral Vector | vGMLV000502 | Human PCNA Lentivirus particle |
ORF Viral Vector | vGMAP000111 | Human PCNA Adenovirus particle |
Target information
Target ID | GM-T21782 |
Target Name | PCNA |
Gene ID | 5111, 18538, 718006, 25737, 101080704, 477166, 515499, 100052065 |
Gene Symbol and Synonyms | ATLD2,PCNA,Pcna/cyclin,PCNAR |
Uniprot Accession | P12004 |
Uniprot Entry Name | PCNA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Aggressive angiomyxoma (AAM), breast cancer, Proliferation and growth regulation |
Gene Ensembl | ENSG00000132646 |
Target Classification | Not Available |
The protein encoded by this gene is found in the nucleus and is a cofactor of DNA polymerase delta. The encoded protein acts as a homotrimer and helps increase the processivity of leading strand synthesis during DNA replication. In response to DNA damage, this protein is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. Two transcript variants encoding the same protein have been found for this gene. Pseudogenes of this gene have been described on chromosome 4 and on the X chromosome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.