Human PCNA/MGC8367 ORF/cDNA clone-Adenovirus plasmid (BC000491)

Pre-made Human PCNA/MGC8367 adenoviral expression plasmid for PCNA adenovirus packaging, PCNA adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to PCNA/MGC8367 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000111 Human PCNA Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000111
Gene Name PCNA
Accession Number BC000491
Gene ID 5111
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias MGC8367
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTCGAGGCGCGCCTGGTCCAGGGCTCCATCCTCAAGAAGGTGTTGGAGGCACTCAAGGACCTCATCAACGAGGCCTGCTGGGATATTAGCTCCAGCGGTGTAAACCTGCAGAGCATGGACTCGTCCCACGTCTCTTTGGTGCAGCTCACCCTGCGGTCTGAGGGCTTCGACACCTACCGCTGCGACCGCAACCTGGCCATGGGCGTGAACCTCACCAGTATGTCCAAAATACTAAAATGCGCCGGCAATGAAGATATCATTACACTAAGGGCCGAAGATAACGCGGATACCTTGGCGCTAGTATTTGAAGCACCAAACCAGGAGAAAGTTTCAGACTATGAAATGAAGTTGATGGATTTAGATGTTGAACAACTTGGAATTCCAGAACAGGAGTACAGCTGTGTAGTAAAGATGCCTTCTGGTGAATTTGCACGTATATGCCGAGATCTCAGCCATATTGGAGATGCTGTTGTAATTTCCTGTGCAAAAGACGGAGTGAAATTTTCTGCAAGTGGAGAACTTGGAAATGGAAACATTAAATTGTCACAGACAAGTAATGTCGATAAAGAGGAGGAAGCTGTTACCATAGAGATGAATGAACCAGTTCAACTAACTTTTGCACTGAGGTACCTGAACTTCTTTACAAAAGCCACTCCACTCTCTTCAACGGTGACACTCAGTATGTCTGCAGATGTACCCCTTGTTGTAGAGTATAAAATTGCGGATATGGGACACTTAAAATACTACTTGGCTCCCAAGATCGAGGATGAAGAAGGATCTTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T21782-Ab Anti-PCNA monoclonal antibody
    Target Antigen GM-Tg-g-T21782-Ag PCNA protein
    ORF Viral Vector pGMLV000281 Human PCNA Lentivirus plasmid
    ORF Viral Vector pGMLV000502 Human PCNA Lentivirus plasmid
    ORF Viral Vector pGMAP000111 Human PCNA Adenovirus plasmid
    ORF Viral Vector vGMLV000281 Human PCNA Lentivirus particle
    ORF Viral Vector vGMLV000502 Human PCNA Lentivirus particle
    ORF Viral Vector vGMAP000111 Human PCNA Adenovirus particle


    Target information

    Target ID GM-T21782
    Target Name PCNA
    Gene ID 5111, 18538, 718006, 25737, 101080704, 477166, 515499, 100052065
    Gene Symbol and Synonyms ATLD2,PCNA,Pcna/cyclin,PCNAR
    Uniprot Accession P12004
    Uniprot Entry Name PCNA_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Aggressive angiomyxoma (AAM), breast cancer, Proliferation and growth regulation
    Gene Ensembl ENSG00000132646
    Target Classification Not Available

    The protein encoded by this gene is found in the nucleus and is a cofactor of DNA polymerase delta. The encoded protein acts as a homotrimer and helps increase the processivity of leading strand synthesis during DNA replication. In response to DNA damage, this protein is ubiquitinated and is involved in the RAD6-dependent DNA repair pathway. Two transcript variants encoding the same protein have been found for this gene. Pseudogenes of this gene have been described on chromosome 4 and on the X chromosome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.