Human SLC7A11/CCBR1/ xCT ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_014331.4)
Pre-made Human SLC7A11/CCBR1/ xCT Non-Viral expression plasmid (overexpression vector) for mouse SLC7A11 overexpression in unique cell transient transfection and stable cell line development.
Go
to SLC7A11/CCBR1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMPC000851 | Human SLC7A11 Mammalian (Non-Viral Vector) plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMPC000851 |
Gene Name | SLC7A11 |
Accession Number | NM_014331.4 |
Gene ID | 23657 |
Species | Human |
Product Type | Mammalian (Non-Viral Vector) plasmid (overexpression) |
Insert Length | 1506 bp |
Gene Alias | CCBR1, xCT |
Fluorescent Reporter | EGFP |
Mammalian Cell Selection | |
Fusion Tag | MYC(C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTCAGAAAGCCTGTTGTGTCCACCATCTCCAAAGGAGGTTACCTGCAGGGAAATGTTAACGGGAGGCTGCCTTCCCTGGGCAACAAGGAGCCACCTGGGCAGGAGAAAGTGCAGCTGAAGAGGAAAGTCACTTTACTGAGGGGAGTCTCCATTATCATTGGCACCATCATTGGAGCAGGAATCTTCATCTCTCCTAAGGGCGTGCTCCAGAACACGGGCAGCGTGGGCATGTCTCTGACCATCTGGACGGTGTGTGGGGTCCTGTCACTATTTGGAGCTTTGTCTTATGCTGAATTGGGAACAACTATAAAGAAATCTGGAGGTCATTACACATATATTTTGGAAGTCTTTGGTCCATTACCAGCTTTTGTACGAGTCTGGGTGGAACTCCTCATAATACGCCCTGCAGCTACTGCTGTGATATCCCTGGCATTTGGACGCTACATTCTGGAACCATTTTTTATTCAATGTGAAATCCCTGAACTTGCGATCAAGCTCATTACAGCTGTGGGCATAACTGTAGTGATGGTCCTAAATAGCATGAGTGTCAGCTGGAGCGCCCGGATCCAGATTTTCTTAACCTTTTGCAAGCTCACAGCAATTCTGATAATTATAGTCCCTGGAGTTATGCAGCTAATTAAAGGTCAAACGCAGAACTTTAAAGACGCCTTTTCAGGAAGAGATTCAAGTATTACGCGGTTGCCACTGGCTTTTTATTATGGAATGTATGCATATGCTGGCTGGTTTTACCTCAACTTTGTTACTGAAGAAGTAGAAAACCCTGAAAAAACCATTCCCCTTGCAATATGTATATCCATGGCCATTGTCACCATTGGCTATGTGCTGACAAATGTGGCCTACTTTACGACCATTAATGCTGAGGAGCTGCTGCTTTCAAATGCAGTGGCAGTGACCTTTTCTGAGCGGCTACTGGGAAATTTCTCATTAGCAGTTCCGATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACTCTGACTGGAGTCCCTGCGTATTATCTCTTTATTATATGGGACAAGAAACCCAGGTGGTTTAGAATAATGTCGGAGAAAATAACCAGAACATTACAAATAATACTGGAAGTTGTACCAGAAGAAGATAAGTTATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T11615-Ab | Anti-XCT/ SLC7A11/ CCBR1 monoclonal antibody |
Target Antigen | GM-Tg-g-T11615-Ag | SLC7A11 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000645 | Human SLC7A11 Lentivirus plasmid |
ORF Viral Vector | pGMAD000772 | Human SLC7A11 Adenovirus plasmid |
ORF Viral Vector | pGMPC000851 | Human SLC7A11 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000895 | Human SLC7A11 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000954 | Human SLC7A11 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP002698 | Human SLC7A11 Lentivirus plasmid |
ORF Viral Vector | vGMLV000645 | Human SLC7A11 Lentivirus particle |
ORF Viral Vector | vGMAD000772 | Human SLC7A11 Adenovirus particle |
ORF Viral Vector | vGMLP002698 | Human SLC7A11 Lentivirus particle |
ORF Viral Vector | pGMLV002270 | Human SLC7A11 Lentivirus plasmid |
ORF Viral Vector | pGMLV002421 | Human SLC7A11 Lentivirus plasmid |
Target information
Target ID | GM-T11615 |
Target Name | SLC7A11 |
Gene ID | 23657, 26570, 696516, 310392, 101099374, 483821, 524078, 100063433 |
Gene Symbol and Synonyms | 9930009M05Rik,CCBR1,SLC7A11,sut,xCT |
Uniprot Accession | Q9UPY5 |
Uniprot Entry Name | XCT_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000151012 |
Target Classification | Not Available |
This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.