Human SLC7A11/CCBR1/ xCT ORF/cDNA clone-Adenovirus plasmid (NM_014331.4)

Pre-made Human SLC7A11/CCBR1/ xCT adenoviral expression plasmid for SLC7A11 adenovirus packaging, SLC7A11 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to SLC7A11/CCBR1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAD000772 Human SLC7A11 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAD000772
Gene Name SLC7A11
Accession Number NM_014331.4
Gene ID 23657
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1506 bp
Gene Alias CCBR1, xCT
Fluorescent Reporter EGFP
Mammalian Cell Selection
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTCAGAAAGCCTGTTGTGTCCACCATCTCCAAAGGAGGTTACCTGCAGGGAAATGTTAACGGGAGGCTGCCTTCCCTGGGCAACAAGGAGCCACCTGGGCAGGAGAAAGTGCAGCTGAAGAGGAAAGTCACTTTACTGAGGGGAGTCTCCATTATCATTGGCACCATCATTGGAGCAGGAATCTTCATCTCTCCTAAGGGCGTGCTCCAGAACACGGGCAGCGTGGGCATGTCTCTGACCATCTGGACGGTGTGTGGGGTCCTGTCACTATTTGGAGCTTTGTCTTATGCTGAATTGGGAACAACTATAAAGAAATCTGGAGGTCATTACACATATATTTTGGAAGTCTTTGGTCCATTACCAGCTTTTGTACGAGTCTGGGTGGAACTCCTCATAATACGCCCTGCAGCTACTGCTGTGATATCCCTGGCATTTGGACGCTACATTCTGGAACCATTTTTTATTCAATGTGAAATCCCTGAACTTGCGATCAAGCTCATTACAGCTGTGGGCATAACTGTAGTGATGGTCCTAAATAGCATGAGTGTCAGCTGGAGCGCCCGGATCCAGATTTTCTTAACCTTTTGCAAGCTCACAGCAATTCTGATAATTATAGTCCCTGGAGTTATGCAGCTAATTAAAGGTCAAACGCAGAACTTTAAAGACGCCTTTTCAGGAAGAGATTCAAGTATTACGCGGTTGCCACTGGCTTTTTATTATGGAATGTATGCATATGCTGGCTGGTTTTACCTCAACTTTGTTACTGAAGAAGTAGAAAACCCTGAAAAAACCATTCCCCTTGCAATATGTATATCCATGGCCATTGTCACCATTGGCTATGTGCTGACAAATGTGGCCTACTTTACGACCATTAATGCTGAGGAGCTGCTGCTTTCAAATGCAGTGGCAGTGACCTTTTCTGAGCGGCTACTGGGAAATTTCTCATTAGCAGTTCCGATCTTTGTTGCCCTCTCCTGCTTTGGCTCCATGAACGGTGGTGTGTTTGCTGTCTCCAGGTTATTCTATGTTGCGTCTCGAGAGGGTCACCTTCCAGAAATCCTCTCCATGATTCATGTCCGCAAGCACACTCCTCTACCAGCTGTTATTGTTTTGCACCCTTTGACAATGATAATGCTCTTCTCTGGAGACCTCGACAGTCTTTTGAATTTCCTCAGTTTTGCCAGGTGGCTTTTTATTGGGCTGGCAGTTGCTGGGCTGATTTATCTTCGATACAAATGCCCAGATATGCATCGTCCTTTCAAGGTGCCACTGTTCATCCCAGCTTTGTTTTCCTTCACATGCCTCTTCATGGTTGCCCTTTCCCTCTATTCGGACCCATTTAGTACAGGGATTGGCTTCGTCATCACTCTGACTGGAGTCCCTGCGTATTATCTCTTTATTATATGGGACAAGAAACCCAGGTGGTTTAGAATAATGTCGGAGAAAATAACCAGAACATTACAAATAATACTGGAAGTTGTACCAGAAGAAGATAAGTTATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T11615-Ab Anti-XCT/ SLC7A11/ CCBR1 monoclonal antibody
    Target Antigen GM-Tg-g-T11615-Ag SLC7A11 VLP (virus-like particle)
    ORF Viral Vector pGMLV000645 Human SLC7A11 Lentivirus plasmid
    ORF Viral Vector pGMAD000772 Human SLC7A11 Adenovirus plasmid
    ORF Viral Vector pGMPC000851 Human SLC7A11 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000895 Human SLC7A11 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000954 Human SLC7A11 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002698 Human SLC7A11 Lentivirus plasmid
    ORF Viral Vector vGMLV000645 Human SLC7A11 Lentivirus particle
    ORF Viral Vector vGMAD000772 Human SLC7A11 Adenovirus particle
    ORF Viral Vector vGMLP002698 Human SLC7A11 Lentivirus particle
    ORF Viral Vector pGMLV002270 Human SLC7A11 Lentivirus plasmid
    ORF Viral Vector pGMLV002421 Human SLC7A11 Lentivirus plasmid


    Target information

    Target ID GM-T11615
    Target Name SLC7A11
    Gene ID 23657, 26570, 696516, 310392, 101099374, 483821, 524078, 100063433
    Gene Symbol and Synonyms 9930009M05Rik,CCBR1,SLC7A11,sut,xCT
    Uniprot Accession Q9UPY5
    Uniprot Entry Name XCT_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000151012
    Target Classification Not Available

    This gene encodes a member of a heteromeric, sodium-independent, anionic amino acid transport system that is highly specific for cysteine and glutamate. In this system, designated Xc(-), the anionic form of cysteine is transported in exchange for glutamate. This protein has been identified as the predominant mediator of Kaposi sarcoma-associated herpesvirus fusion and entry permissiveness into cells. Also, increased expression of this gene in primary gliomas (compared to normal brain tissue) was associated with increased glutamate secretion via the XCT channels, resulting in neuronal cell death. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.