Human RDH12/FLJ30273/ LCA3 ORF/cDNA clone-Lentivirus plasmid (BC025724)
Pre-made Human RDH12/FLJ30273/ LCA3 Lentiviral expression plasmid for RDH12 lentivirus packaging, RDH12 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RDH12/FLJ30273 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLP003880 | Human RDH12 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLP003880 |
Gene Name | RDH12 |
Accession Number | BC025724 |
Gene ID | 145226 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 951 bp |
Gene Alias | FLJ30273, LCA3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGGTCACCTTGGGACTGCTCACCTCCTTCTTCTCGTTCCTGTATATGGTAGCTCCATCCATCAGGAAGTTCTTTGCTGGTGGAGTGTGTAGAACAAATGTGCAGCTTCCTGGCAAGGTAGTGGTGATCACTGGCGCCAACACGGGCATTGGCAAGGAGACGGCCAGAGAGCTCGCTAGCCGAGGAGCCCGAGTCTATATTGCCTGCAGAGATGTACTGAAGGGGGAGTCTGCTGCCAGTGAAATCCGAGTGGATACAAAGAACTCCCAGGTGCTGGTGCGGAAATTGGACCTATCCGACACCAAATCTATCCGAGCCTTTGCTGAGGGCTTTCTGGCAGAGGAAAAGCAGCTCCATATTCTGATCAACAATGCGGGAGTAATGATGTGTCCATATTCCAAGACAGCTGATGGCTTTGAAACCCACCTGGGAGTCAACCACCTGGGCCACTTCCTCCTCACCTACCTGCTCCTGGAGCAGCTAAAGGTGTCTGCCCCTGCACGGGTGGTTAATGTGTCCTCGGTGGCTCACCACATTGGCAAGATTCCCTTCCACGACCTCCAGAGCGAGAAGCGCTACAGCAGGGGTTTTGCCTATTGCCACAGCAAGCTGGCCAATGTGCTTTTTACTCGTGAGCTGGCCAAGAGGCTCCAAGGCACCGGGGTCACCACCTACGCAGTGCACCCAGGCGTCGTCCGCTCTGAGCTGGTCCGGCACTCCTCCCTGCTCTGCCTGCTCTGGCGGCTCTTCTCCCCCTTTGTCAAGACGGCACGGGAGGGGGCGCAGACCAGCCTGCACTGCGCCCTGGCTGAGGGCCTGGAGCCCCTGAGTGGCAAGTACTTCAGTGACTGCAAGAGGACCTGGGTGTCTCCAAGGGCCCGAAATAACAAAACAGCTGAGCGCCTATGGAATGTCAGCTGTGAGCTTCTAGGAATCCGGTGGGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1513-Ab | Anti-RDH12/ LCA13/ RP53 functional antibody |
Target Antigen | GM-Tg-g-SE1513-Ag | RDH12 protein |
ORF Viral Vector | pGMLP003533 | Human RDH12 Lentivirus plasmid |
ORF Viral Vector | pGMLP003880 | Human RDH12 Lentivirus plasmid |
ORF Viral Vector | vGMLP003533 | Human RDH12 Lentivirus particle |
ORF Viral Vector | vGMLP003880 | Human RDH12 Lentivirus particle |
Target information
Target ID | GM-SE1513 |
Target Name | RDH12 |
Gene ID | 145226, 77974, 711438, 314264, 101093615, 490744, 369021, 100063369 |
Gene Symbol and Synonyms | DSSDR2,LCA13,RDH12,RP53,SDR7C2 |
Uniprot Accession | Q96NR8 |
Uniprot Entry Name | RDH12_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000139988 |
Target Classification | Not Available |
The protein encoded by this gene is an NADPH-dependent retinal reductase whose highest activity is toward 9-cis and all-trans-retinol. The encoded enzyme also plays a role in the metabolism of short-chain aldehydes but does not exhibit steroid dehydrogenase activity. Defects in this gene are a cause of Leber congenital amaurosis type 13 and Retinitis Pigmentosa 53. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.