Human RDH12/LCA13/RP53 ORF/cDNA clone-Adeno-associate virus(AAV) plasmid (NM_152443.2)

Cat. No.: pGMAAV001534
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human RDH12/LCA13/RP53 Adeno-associated virus expression plasmid (ITR-vector) for RDH12 AAV packaging, RDH12 AAV production.The purified Human RDH12/LCA13/RP53 AAV particle serves as an invaluable asset for in-depth in vivo RDH12 studies, mechanism of action (MOA) research, and the evolution of RDH12-associated gene therapy strategies.

Our GM-AAV ITR vector is optimized with the G-NEXT™ multi-serotypes AAV vector system. Explore the G-NEXT™ system in detail.


Target products collection

Go to RDH12/LCA13 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAAV001534
Gene Name RDH12
Accession Number NM_152443.2
Gene ID 145226
Species Human
Product Type Adeno-associate virus(AAV) plasmid (overexpression)
Insert Length 951 bp
Gene Alias LCA13,RP53,SDR7C2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag 1xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGGTCACCTTGGGACTGCTCACCTCCTTCTTCTCGTTCCTGTATATGGTAGCTCCATCCATCAGGAAGTTCTTTGCTGGTGGAGTGTGTAGAACAAATGTGCAGCTTCCTGGCAAGGTAGTGGTGATCACTGGCGCCAACACGGGCATTGGCAAGGAGACGGCCAGAGAGCTCGCTAGCCGAGGAGCCCGAGTCTATATTGCCTGCAGAGATGTACTGAAGGGGGAGTCTGCTGCCAGTGAAATCCGAGTGGATACAAAGAACTCCCAGGTGCTGGTGCGGAAATTGGACCTATCCGACACCAAATCTATCCGAGCCTTTGCTGAGGGCTTTCTGGCAGAGGAAAAGCAGCTCCATATTCTGATCAACAATGCGGGAGTAATGATGTGTCCATATTCCAAGACAGCTGATGGCTTTGAAACCCACCTGGGAGTCAACCACCTGGGCCACTTCCTCCTCACCTACCTGCTCCTGGAGCGGCTAAAGGTGTCTGCCCCTGCACGGGTGGTTAATGTGTCCTCGGTGGCTCACCACATTGGCAAGATTCCCTTCCACGACCTCCAGAGCGAGAAGCGCTACAGCAGGGGTTTTGCCTATTGCCACAGCAAGCTGGCCAATGTGCTTTTTACTCGTGAGCTGGCCAAGAGGCTCCAAGGCACCGGGGTCACCACCTACGCAGTGCACCCAGGCGTCGTCCGCTCTGAGCTGGTCCGGCACTCCTCCCTGCTCTGCCTGCTCTGGCGGCTCTTCTCCCCCTTTGTCAAGACGGCACGGGAGGGGGCGCAGACCAGCCTGCACTGCGCCCTGGCTGAGGGCCTGGAGCCCCTGAGTGGCAAGTACTTCAGTGACTGCAAGAGGACCTGGGTGTCTCCAAGGGCCCGAAATAACAAAACAGCTGAGCGCCTATGGAATGTCAGCTGTGAGCTTCTAGGAATCCGGTGGGAGTAG
ORF Protein Sequence MLVTLGLLTSFFSFLYMVAPSIRKFFAGGVCRTNVQLPGKVVVITGANTGIGKETARELASRGARVYIACRDVLKGESAASEIRVDTKNSQVLVRKLDLSDTKSIRAFAEGFLAEEKQLHILINNAGVMMCPYSKTADGFETHLGVNHLGHFLLTYLLLERLKVSAPARVVNVSSVAHHIGKIPFHDLQSEKRYSRGFAYCHSKLANVLFTRELAKRLQGTGVTTYAVHPGVVRSELVRHSSLLCLLWRLFSPFVKTAREGAQTSLHCALAEGLEPLSGKYFSDCKRTWVSPRARNNKTAERLWNVSCELLGIRWE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1513-Ab Anti-RDH12/ LCA13/ RP53 functional antibody
    Target Antigen GM-Tg-g-SE1513-Ag RDH12 protein
    ORF Viral Vector pGMLP003533 Human RDH12 Lentivirus plasmid
    ORF Viral Vector pGMLP003880 Human RDH12 Lentivirus plasmid
    ORF Viral Vector pGMAAV001533 Human RDH12 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001534 Human RDH12 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector vGMLP003533 Human RDH12 Lentivirus particle
    ORF Viral Vector vGMLP003880 Human RDH12 Lentivirus particle
    ORF Viral Vector vGMAAV001533 Human RDH12 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001534 Human RDH12 Adeno-associate virus(AAV) particle


    Target information

    Target ID GM-SE1513
    Target Name RDH12
    Gene ID 145226, 77974, 711438, 314264, 101093615, 490744, 369021, 100063369
    Gene Symbol and Synonyms DSSDR2,LCA13,RDH12,RP53,SDR7C2
    Uniprot Accession Q96NR8
    Uniprot Entry Name RDH12_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000139988
    Target Classification Not Available

    The protein encoded by this gene is an NADPH-dependent retinal reductase whose highest activity is toward 9-cis and all-trans-retinol. The encoded enzyme also plays a role in the metabolism of short-chain aldehydes but does not exhibit steroid dehydrogenase activity. Defects in this gene are a cause of Leber congenital amaurosis type 13 and Retinitis Pigmentosa 53. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.