Human S100A8/60B8AG/ CAGA ORF/cDNA clone-Lentivirus plasmid (NM_002964)

Pre-made Human S100A8/60B8AG/ CAGA Lentiviral expression plasmid for S100A8 lentivirus packaging, S100A8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to S100A8/60B8AG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLP000464 Human S100A8 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLP000464
Gene Name S100A8
Accession Number NM_002964
Gene ID 6279
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 282 bp
Gene Alias 60B8AG, CAGA, CFAG, CGLA, CP-10, L1Ag, MA387, MIF, MRP8, NIF, P8
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTGACCGAGCTGGAGAAAGCCTTGAACTCTATCATCGACGTCTACCACAAGTACTCCCTGATAAAGGGGAATTTCCATGCCGTCTACAGGGATGACCTGAAGAAATTGCTAGAGACCGAGTGTCCTCAGTATATCAGGAAAAAGGGTGCAGACGTCTGGTTCAAAGAGTTGGATATCAACACTGATGGTGCAGTTAACTTCCAGGAGTTCCTCATTCTGGTGATAAAGATGGGCGTGGCAGCCCACAAAAAAAGCCATGAAGAAAGCCACAAAGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27402-Ab Anti-S10A8/ S100A8/ 60B8AG monoclonal antibody
    Target Antigen GM-Tg-g-T27402-Ag S100A8 VLP (virus-like particle)
    ORF Viral Vector pGMLV000491 Human S100A8 Lentivirus plasmid
    ORF Viral Vector pGMLV000751 Human S100A8 Lentivirus plasmid
    ORF Viral Vector pGMLP000464 Human S100A8 Lentivirus plasmid
    ORF Viral Vector pGMAP000312 Human S100A8 Adenovirus plasmid
    ORF Viral Vector vGMLV000491 Human S100A8 Lentivirus particle
    ORF Viral Vector vGMLV000751 Human S100A8 Lentivirus particle
    ORF Viral Vector vGMLP000464 Human S100A8 Lentivirus particle
    ORF Viral Vector vGMAP000312 Human S100A8 Adenovirus particle
    ORF Viral Vector pGMLV002423 Mouse S100a8 Lentivirus plasmid


    Target information

    Target ID GM-T27402
    Target Name S100A8
    Gene ID 6279, 20201, 714740, 116547, 101084164, 490461, 616818, 100061766
    Gene Symbol and Synonyms 60B8AG,B8Ag,CAGA,CFAG,CGLA,CP-10,L1Ag,MA387,MIF,MRP8,NIF,P8,S100-A8,S100A8
    Uniprot Accession P05109
    Uniprot Entry Name S10A8_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Acute appendicitis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to environmental tobacco smoke (acute) (chronic), Malignant neoplasm of bladder
    Gene Ensembl ENSG00000143546
    Target Classification Not Available

    The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and as a cytokine. Altered expression of this protein is associated with the disease cystic fibrosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.