Human S100A8/60B8AG/ CGLA ORF/cDNA clone-Adenovirus plasmid (BC005928)
Pre-made Human S100A8/60B8AG/ CGLA adenoviral expression plasmid for S100A8 adenovirus packaging, S100A8 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to S100A8/60B8AG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000312 | Human S100A8 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000312 |
Gene Name | S100A8 |
Accession Number | BC005928 |
Gene ID | 6279 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 282 bp |
Gene Alias | 60B8AG, CGLA, CP-10, L1Ag, MA387, MIF, MRP8, NIF, P8 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTGACCGAGCTGGAGAAAGCCTTGAACTCTATCATCGACGTCTACCACAAGTACTCCCTGATAAAGGGGAATTTCCATGCCGTCTACAGGGATGACCTGAAGAAATTGCTAGAGACCGAGTGTCCTCAGTATATCAGGAAAAAGGGTGCAGACGTCTGGTTCAAAGAGTTGGATATCAACACTGATGGTGCAGTTAACTTCCAGGAGTTCCTCATTCTGGTGATAAAGATGGGCGTGGCAGCCCACAAAAAAAGCCATGAAGAAAGCCACAAAGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T27402-Ab | Anti-S10A8/ S100A8/ 60B8AG monoclonal antibody |
Target Antigen | GM-Tg-g-T27402-Ag | S100A8 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000491 | Human S100A8 Lentivirus plasmid |
ORF Viral Vector | pGMLV000751 | Human S100A8 Lentivirus plasmid |
ORF Viral Vector | pGMLP000464 | Human S100A8 Lentivirus plasmid |
ORF Viral Vector | pGMAP000312 | Human S100A8 Adenovirus plasmid |
ORF Viral Vector | vGMLV000491 | Human S100A8 Lentivirus particle |
ORF Viral Vector | vGMLV000751 | Human S100A8 Lentivirus particle |
ORF Viral Vector | vGMLP000464 | Human S100A8 Lentivirus particle |
ORF Viral Vector | vGMAP000312 | Human S100A8 Adenovirus particle |
ORF Viral Vector | pGMLV002423 | Mouse S100a8 Lentivirus plasmid |
Target information
Target ID | GM-T27402 |
Target Name | S100A8 |
Gene ID | 6279, 20201, 714740, 116547, 101084164, 490461, 616818, 100061766 |
Gene Symbol and Synonyms | 60B8AG,B8Ag,CAGA,CFAG,CGLA,CP-10,L1Ag,MA387,MIF,MRP8,NIF,P8,S100-A8,S100A8 |
Uniprot Accession | P05109 |
Uniprot Entry Name | S10A8_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Diagnostics Biomarker |
Disease | Acute appendicitis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to environmental tobacco smoke (acute) (chronic), Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000143546 |
Target Classification | Not Available |
The protein encoded by this gene is a member of the S100 family of proteins containing 2 EF-hand calcium-binding motifs. S100 proteins are localized in the cytoplasm and/or nucleus of a wide range of cells, and involved in the regulation of a number of cellular processes such as cell cycle progression and differentiation. S100 genes include at least 13 members which are located as a cluster on chromosome 1q21. This protein may function in the inhibition of casein kinase and as a cytokine. Altered expression of this protein is associated with the disease cystic fibrosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.