Human NEU1/NANH/NEU ORF/cDNA clone-Lentivirus particle (NM_000434.4)

SKU: vGMLV002700
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NEU1/NANH/NEU Lentiviral expression plasmid for NEU1 lentivirus packaging, NEU1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to NEU1/NANH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002700 Human NEU1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002700
Gene Name NEU1
Accession Number NM_000434.4
Gene ID 4758
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1248 bp
Gene Alias NANH,NEU,SIAL1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACTGGGGAGCGACCCAGCACGGCGCTCCCGGACAGACGCTGGGGGCCGCGGATTCTGGGCTTCTGGGGAGGCTGTAGGGTTTGGGTGTTTGCCGCGATCTTCCTGCTGCTGTCTCTGGCAGCCTCCTGGTCCAAGGCTGAGAACGACTTCGGTCTGGTGCAGCCGCTGGTGACCATGGAGCAACTGCTGTGGGTGAGCGGGAGACAGATCGGCTCAGTGGACACCTTCCGCATCCCGCTCATCACAGCCACTCCGCGGGGCACTCTTCTCGCCTTTGCTGAGGCGAGGAAAATGTCCTCATCCGATGAGGGGGCCAAGTTCATCGCCCTGCGGAGGTCCATGGACCAGGGCAGCACATGGTCTCCTACAGCGTTCATTGTCAATGATGGGGATGTCCCCGATGGGCTGAACCTTGGGGCAGTAGTGAGCGATGTTGAGACAGGAGTAGTATTTCTTTTCTACTCCCTTTGTGCTCACAAGGCCGGCTGCCAGGTGGCCTCTACCATGTTGGTATGGAGCAAGGATGATGGTGTTTCCTGGAGCACACCCCGGAATCTCTCCCTGGATATTGGCACTGAAGTGTTTGCCCCTGGACCGGGCTCTGGTATTCAGAAACAGCGGGAGCCACGGAAGGGCCGCCTCATCGTGTGTGGCCATGGGACGCTGGAGCGGGACGGAGTCTTCTGTCTCCTCAGCGATGATCATGGTGCCTCCTGGCGCTACGGAAGTGGGGTCAGCGGCATCCCCTACGGTCAGCCCAAGCAGGAAAATGATTTCAATCCTGATGAATGCCAGCCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCACTGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGATGTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGCTCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCCGAGTGAACCTGACCCTGCGATGGAGCTTCAGCAATGGTACCTCATGGCGGAAAGAGACAGTCCAGCTATGGCCAGGCCCCAGTGGCTATTCATCCCTGGCAACCCTGGAGGGCAGCATGGATGGAGAGGAGCAGGCCCCCCAGCTCTACGTCCTGTATGAGAAAGGCCGGAACCACTACACAGAGAGCATCTCCGTGGCCAAAATCAGTGTCTATGGGACACTCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0874-Ab Anti-NEUR1/ NEU1/ NANH monoclonal antibody
    Target Antigen GM-Tg-g-MP0874-Ag NEU1 VLP (virus-like particle)
    ORF Viral Vector pGMLV002700 Human NEU1 Lentivirus plasmid
    ORF Viral Vector pGMAAV000260 Human NEU1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000796 Human NEU1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV001253 Human NEU1 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000094 Human NEU1 Adenovirus plasmid
    ORF Viral Vector pGMPC001869 Human NEU1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002700 Human NEU1 Lentivirus particle
    ORF Viral Vector vGMAAV000260 Human NEU1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000796 Human NEU1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV001253 Human NEU1 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000094 Human NEU1 Adenovirus particle


    Target information

    Target ID GM-MP0874
    Target Name NEU1
    Gene ID 4758, 18010, 716740, 24591, 101091282, 481717, 505554, 100059083
    Gene Symbol and Synonyms Aglp,Apl,Bat-7,Bat7,G9,Map-2,NANH,NEU,Neu-1,NEU1,SIAL1
    Uniprot Accession Q99519
    Uniprot Entry Name NEUR1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000204386
    Target Classification Not Available

    The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.