Human NEU1/NANH/NEU ORF/cDNA clone-Lentivirus particle (NM_000434.4)
SKU: vGMLV002700
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human NEU1/NANH/NEU Lentiviral expression plasmid for NEU1 lentivirus packaging, NEU1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
NEU1/NANH products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV002700 | Human NEU1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV002700 |
Gene Name | NEU1 |
Accession Number | NM_000434.4 |
Gene ID | 4758 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1248 bp |
Gene Alias | NANH,NEU,SIAL1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACTGGGGAGCGACCCAGCACGGCGCTCCCGGACAGACGCTGGGGGCCGCGGATTCTGGGCTTCTGGGGAGGCTGTAGGGTTTGGGTGTTTGCCGCGATCTTCCTGCTGCTGTCTCTGGCAGCCTCCTGGTCCAAGGCTGAGAACGACTTCGGTCTGGTGCAGCCGCTGGTGACCATGGAGCAACTGCTGTGGGTGAGCGGGAGACAGATCGGCTCAGTGGACACCTTCCGCATCCCGCTCATCACAGCCACTCCGCGGGGCACTCTTCTCGCCTTTGCTGAGGCGAGGAAAATGTCCTCATCCGATGAGGGGGCCAAGTTCATCGCCCTGCGGAGGTCCATGGACCAGGGCAGCACATGGTCTCCTACAGCGTTCATTGTCAATGATGGGGATGTCCCCGATGGGCTGAACCTTGGGGCAGTAGTGAGCGATGTTGAGACAGGAGTAGTATTTCTTTTCTACTCCCTTTGTGCTCACAAGGCCGGCTGCCAGGTGGCCTCTACCATGTTGGTATGGAGCAAGGATGATGGTGTTTCCTGGAGCACACCCCGGAATCTCTCCCTGGATATTGGCACTGAAGTGTTTGCCCCTGGACCGGGCTCTGGTATTCAGAAACAGCGGGAGCCACGGAAGGGCCGCCTCATCGTGTGTGGCCATGGGACGCTGGAGCGGGACGGAGTCTTCTGTCTCCTCAGCGATGATCATGGTGCCTCCTGGCGCTACGGAAGTGGGGTCAGCGGCATCCCCTACGGTCAGCCCAAGCAGGAAAATGATTTCAATCCTGATGAATGCCAGCCCTATGAGCTCCCAGATGGCTCAGTCGTCATCAATGCCCGAAACCAGAACAACTACCACTGCCACTGCCGAATTGTCCTCCGCAGCTATGATGCCTGTGATACACTAAGGCCCCGTGATGTGACCTTCGACCCTGAGCTCGTGGACCCTGTGGTAGCTGCAGGAGCTGTAGTCACCAGCTCCGGCATTGTCTTCTTCTCCAACCCAGCACATCCAGAGTTCCGAGTGAACCTGACCCTGCGATGGAGCTTCAGCAATGGTACCTCATGGCGGAAAGAGACAGTCCAGCTATGGCCAGGCCCCAGTGGCTATTCATCCCTGGCAACCCTGGAGGGCAGCATGGATGGAGAGGAGCAGGCCCCCCAGCTCTACGTCCTGTATGAGAAAGGCCGGAACCACTACACAGAGAGCATCTCCGTGGCCAAAATCAGTGTCTATGGGACACTCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0874-Ab | Anti-NEUR1/ NEU1/ NANH monoclonal antibody |
Target Antigen | GM-Tg-g-MP0874-Ag | NEU1 VLP (virus-like particle) |
ORF Viral Vector | pGMLV002700 | Human NEU1 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000260 | Human NEU1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000796 | Human NEU1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV001253 | Human NEU1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000094 | Human NEU1 Adenovirus plasmid |
ORF Viral Vector | pGMPC001869 | Human NEU1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV002700 | Human NEU1 Lentivirus particle |
ORF Viral Vector | vGMAAV000260 | Human NEU1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000796 | Human NEU1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV001253 | Human NEU1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000094 | Human NEU1 Adenovirus particle |
Target information
Target ID | GM-MP0874 |
Target Name | NEU1 |
Gene ID | 4758, 18010, 716740, 24591, 101091282, 481717, 505554, 100059083 |
Gene Symbol and Synonyms | Aglp,Apl,Bat-7,Bat7,G9,Map-2,NANH,NEU,Neu-1,NEU1,SIAL1 |
Uniprot Accession | Q99519 |
Uniprot Entry Name | NEUR1_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000204386 |
Target Classification | Not Available |
The protein encoded by this gene is a lysosomal enzyme that cleaves terminal sialic acid residues from substrates such as glycoproteins and glycolipids. In the lysosome, this enzyme is part of a heterotrimeric complex together with beta-galactosidase and cathepsin A (the latter is also referred to as 'protective protein'). Mutations in this gene can lead to sialidosis, a lysosomal storage disease that can be type 1 (cherry red spot-myoclonus syndrome or normosomatic type), which is late-onset, or type 2 (the dysmorphic type), which occurs at an earlier age with increased severity. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.