Human IGFBP2/IBP2/IGF-BP53 ORF/cDNA clone-Lentivirus particle (NM_000597.3)

Cat. No.: vGMLV002545

Pre-made Human IGFBP2/IBP2/IGF-BP53 Lentiviral expression plasmid for IGFBP2 lentivirus packaging, IGFBP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IGFBP2/IBP2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002545 Human IGFBP2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002545
Gene Name IGFBP2
Accession Number NM_000597.3
Gene ID 3485
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 978 bp
Gene Alias IBP2,IGF-BP53
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCTGCCGAGAGTGGGCTGCCCCGCGCTGCCGCTGCCGCCGCCGCCGCTGCTGCCGCTGCTGCTGCTGCTACTGGGCGCGAGTGGCGGCGGCGGCGGGGCGCGCGCGGAGGTGCTGTTCCGCTGCCCGCCCTGCACACCCGAGCGCCTGGCCGCCTGCGGGCCCCCGCCGGTTGCGCCGCCCGCCGCGGTGGCCGCAGTGGCCGGAGGCGCCCGCATGCCATGCGCGGAGCTCGTCCGGGAGCCGGGCTGCGGCTGCTGCTCGGTGTGCGCCCGGCTGGAGGGCGAGGCGTGCGGCGTCTACACCCCGCGCTGCGGCCAGGGGCTGCGCTGCTATCCCCACCCGGGCTCCGAGCTGCCCCTGCAGGCGCTGGTCATGGGCGAGGGCACTTGTGAGAAGCGCCGGGACGCCGAGTATGGCGCCAGCCCGGAGCAGGTTGCAGACAATGGCGATGACCACTCAGAAGGAGGCCTGGTGGAGAACCACGTGGACAGCACCATGAACATGTTGGGCGGGGGAGGCAGTGCTGGCCGGAAGCCCCTCAAGTCGGGTATGAAGGAGCTGGCCGTGTTCCGGGAGAAGGTCACTGAGCAGCACCGGCAGATGGGCAAGGGTGGCAAGCATCACCTTGGCCTGGAGGAGCCCAAGAAGCTGCGACCACCCCCTGCCAGGACTCCCTGCCAACAGGAACTGGACCAGGTCCTGGAGCGGATCTCCACCATGCGCCTTCCGGATGAGCGGGGCCCTCTGGAGCACCTCTACTCCCTGCACATCCCCAACTGTGACAAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T64268-Ab Anti-IBP2/ IGFBP2/ IGF-BP53 functional antibody
    Target Antigen GM-Tg-g-T64268-Ag IGFBP2 protein
    Cytokine cks-Tg-g-GM-T64268 insulin-like growth factor binding protein 2, 36kDa (IGFBP2) protein & antibody
    ORF Viral Vector pGMLP004595 Human IGFBP2 Lentivirus plasmid
    ORF Viral Vector pGMLV002545 Human IGFBP2 Lentivirus plasmid
    ORF Viral Vector pGMPC001682 Human IGFBP2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004595 Human IGFBP2 Lentivirus particle
    ORF Viral Vector vGMLV002545 Human IGFBP2 Lentivirus particle


    Target information

    Target ID GM-T64268
    Target Name IGFBP2
    Gene ID 3485, 16008, 696214, 25662, 101088426, 488516, 282260, 100034061
    Gene Symbol and Synonyms BRL-BP,IBP-2,IBP2,IGF-BP53,Igfbp-2,IGFBP2,ILGFBPA,mIGFBP-2
    Uniprot Accession P18065
    Uniprot Entry Name IBP2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, Cytokine Target
    Disease Ovary Cancer, Dent disease
    Gene Ensembl ENSG00000115457
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is one of six similar proteins that bind insulin-like growth factors I and II (IGF-I and IGF-II). The encoded protein can be secreted into the bloodstream, where it binds IGF-I and IGF-II with high affinity, or it can remain intracellular, interacting with many different ligands. High expression levels of this protein promote the growth of several types of tumors and may be predictive of the chances of recovery of the patient. Several transcript variants, one encoding a secreted isoform and the others encoding nonsecreted isoforms, have been found for this gene. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.