Human IGFBP2/IBP2/IGF-BP53 ORF/cDNA clone-Lentivirus plasmid (NM_000597)
Cat. No.: pGMLP004595
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IGFBP2/IBP2/IGF-BP53 Lentiviral expression plasmid for IGFBP2 lentivirus packaging, IGFBP2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IGFBP2/IBP2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP004595 |
Gene Name | IGFBP2 |
Accession Number | NM_000597 |
Gene ID | 3485 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 987 bp |
Gene Alias | IBP2,IGF-BP53 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCTGCCGAGAGTGGGCTGCCCCGCGCTGCCGCTGCCGCCGCCGCCGCTGCTGCCGCTGCTGCCGCTGCTGCTGCTGCTACTGGGCGCGAGTGGCGGCGGCGGCGGGGCGCGCGCGGAGGTGCTGTTCCGCTGCCCGCCCTGCACACCCGAGCGCCTGGCCGCCTGCGGGCCCCCGCCGGTTGCGCCGCCCGCCGCGGTGGCCGCAGTGGCCGGAGGCGCCCGCATGCCATGCGCGGAGCTCGTCCGGGAGCCGGGCTGCGGCTGCTGCTCGGTGTGCGCCCGGCTGGAGGGCGAGGCGTGCGGCGTCTACACCCCGCGCTGCGGCCAGGGGCTGCGCTGCTATCCCCACCCGGGCTCCGAGCTGCCCCTGCAGGCGCTGGTCATGGGCGAGGGCACTTGTGAGAAGCGCCGGGACGCCGAGTATGGCGCCAGCCCGGAGCAGGTTGCAGACAATGGCGATGACCACTCAGAAGGAGGCCTGGTGGAGAACCACGTGGACAGCACCATGAACATGTTGGGCGGGGGAGGCAGTGCTGGCCGGAAGCCCCTCAAGTCGGGTATGAAGGAGCTGGCCGTGTTCCGGGAGAAGGTCACTGAGCAGCACCGGCAGATGGGCAAGGGTGGCAAGCATCACCTTGGCCTGGAGGAGCCCAAGAAGCTGCGACCACCCCCTGCCAGGACTCCCTGCCAACAGGAACTGGACCAGGTCCTGGAGCGGATCTCCACCATGCGCCTTCCGGATGAGCGGGGCCCTCTGGAGCACCTCTACTCCCTGCACATCCCCAACTGTGACAAGCATGGCCTGTACAACCTCAAACAGTGCAAGATGTCTCTGAACGGGCAGCGTGGGGAGTGCTGGTGTGTGAACCCCAACACCGGGAAGCTGATCCAGGGAGCCCCCACCATCCGGGGGGACCCCGAGTGTCATCTCTTCTACAATGAGCAGCAGGAGGCTCGCGGGGTGCACACCCAGCGGATGCAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T64268-Ab | Anti-IBP2/ IGFBP2/ IGF-BP53 functional antibody |
Target Antigen | GM-Tg-g-T64268-Ag | IGFBP2 protein |
Cytokine | cks-Tg-g-GM-T64268 | insulin-like growth factor binding protein 2, 36kDa (IGFBP2) protein & antibody |
ORF Viral Vector | pGMLP004595 | Human IGFBP2 Lentivirus plasmid |
ORF Viral Vector | pGMLV002545 | Human IGFBP2 Lentivirus plasmid |
ORF Viral Vector | pGMPC001682 | Human IGFBP2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP004595 | Human IGFBP2 Lentivirus particle |
ORF Viral Vector | vGMLV002545 | Human IGFBP2 Lentivirus particle |
Target information
Target ID | GM-T64268 |
Target Name | IGFBP2 |
Gene ID | 3485, 16008, 696214, 25662, 101088426, 488516, 282260, 100034061 |
Gene Symbol and Synonyms | BRL-BP,IBP-2,IBP2,IGF-BP53,Igfbp-2,IGFBP2,ILGFBPA,mIGFBP-2 |
Uniprot Accession | P18065 |
Uniprot Entry Name | IBP2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Ovary Cancer, Dent disease |
Gene Ensembl | ENSG00000115457 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is one of six similar proteins that bind insulin-like growth factors I and II (IGF-I and IGF-II). The encoded protein can be secreted into the bloodstream, where it binds IGF-I and IGF-II with high affinity, or it can remain intracellular, interacting with many different ligands. High expression levels of this protein promote the growth of several types of tumors and may be predictive of the chances of recovery of the patient. Several transcript variants, one encoding a secreted isoform and the others encoding nonsecreted isoforms, have been found for this gene. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.