Human CXCL13/ANGIE/ANGIE2 ORF/cDNA clone-Lentivirus particle (NM_001371558.1)

SKU: vGMLV002529
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CXCL13/ANGIE/ANGIE2 Lentiviral expression plasmid for CXCL13 lentivirus packaging, CXCL13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to CXCL13/ANGIE products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002529 Human CXCL13 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002529
Gene Name CXCL13
Accession Number NM_001371558.1
Gene ID 10563
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 330 bp
Gene Alias ANGIE,ANGIE2,BCA-1,BCA1,BLC,BLR1L,SCYB13
Fluorescent Reporter mCherry
Mammalian Cell Selection Neomycin
Fusion Tag HA (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGTTCATCTCGACATCTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTTCTGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGCTTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAGAAGAACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGAAAAAGAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T27700-Ab Anti-CXL13/ CXCL13/ ANGIE functional antibody
    Target Antigen GM-Tg-g-T27700-Ag CXCL13 protein
    Cytokine cks-Tg-g-GM-T27700 chemokine (C-X-C motif) ligand 13 (CXCL13) protein & antibody
    ORF Viral Vector pGMLP001932 Human CXCL13 Lentivirus plasmid
    ORF Viral Vector pGMLV002529 Human CXCL13 Lentivirus plasmid
    ORF Viral Vector pGMLV002536 Human CXCL13 Lentivirus plasmid
    ORF Viral Vector vGMLP001932 Human CXCL13 Lentivirus particle
    ORF Viral Vector vGMLV002529 Human CXCL13 Lentivirus particle
    ORF Viral Vector vGMLV002536 Human CXCL13 Lentivirus particle


    Target information

    Target ID GM-T27700
    Target Name CXCL13
    Gene ID 10563, 55985, 574224, 498335, 101096888, 608156, 511674, 100629997
    Gene Symbol and Synonyms 4631412M08Rik,ANGIE,ANGIE2,BCA-1,BCA1,BLC,BLR1L,CXCL13,SCYB13
    Uniprot Accession O43927
    Uniprot Entry Name CXL13_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000156234
    Target Classification Not Available

    B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.