Human CXCL13/ANGIE/ANGIE2 ORF/cDNA clone-Lentivirus plasmid (NM_001371558.1)
SKU: pGMLV002529
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CXCL13/ANGIE/ANGIE2 Lentiviral expression plasmid for CXCL13 lentivirus packaging, CXCL13 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CXCL13/ANGIE products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV002529 |
Gene Name | CXCL13 |
Accession Number | NM_001371558.1 |
Gene ID | 10563 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 330 bp |
Gene Alias | ANGIE,ANGIE2,BCA-1,BCA1,BLC,BLR1L,SCYB13 |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Neomycin |
Fusion Tag | HA (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAGTTCATCTCGACATCTCTGCTTCTCATGCTGCTGGTCAGCAGCCTCTCTCCAGTCCAAGGTGTTCTGGAGGTCTATTACACAAGCTTGAGGTGTAGATGTGTCCAAGAGAGCTCAGTCTTTATCCCTAGACGCTTCATTGATCGAATTCAAATCTTGCCCCGTGGGAATGGTTGTCCAAGAAAAGAAATCATAGTCTGGAAGAAGAACAAGTCAATTGTGTGTGTGGACCCTCAAGCTGAATGGATACAAAGAATGATGGAAGTATTGAGAAAAAGAAGTTCTTCAACTCTACCAGTTCCAGTGTTTAAGAGAAAGATTCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T27700-Ab | Anti-CXL13/ CXCL13/ ANGIE functional antibody |
Target Antigen | GM-Tg-g-T27700-Ag | CXCL13 protein |
Cytokine | cks-Tg-g-GM-T27700 | chemokine (C-X-C motif) ligand 13 (CXCL13) protein & antibody |
ORF Viral Vector | pGMLP001932 | Human CXCL13 Lentivirus plasmid |
ORF Viral Vector | pGMLV002529 | Human CXCL13 Lentivirus plasmid |
ORF Viral Vector | pGMLV002536 | Human CXCL13 Lentivirus plasmid |
ORF Viral Vector | vGMLP001932 | Human CXCL13 Lentivirus particle |
ORF Viral Vector | vGMLV002529 | Human CXCL13 Lentivirus particle |
ORF Viral Vector | vGMLV002536 | Human CXCL13 Lentivirus particle |
Target information
Target ID | GM-T27700 |
Target Name | CXCL13 |
Gene ID | 10563, 55985, 574224, 498335, 101096888, 608156, 511674, 100629997 |
Gene Symbol and Synonyms | 4631412M08Rik,ANGIE,ANGIE2,BCA-1,BCA1,BLC,BLR1L,CXCL13,SCYB13 |
Uniprot Accession | O43927 |
Uniprot Entry Name | CXL13_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Lung Cancer |
Gene Ensembl | ENSG00000156234 |
Target Classification | Not Available |
B lymphocyte chemoattractant, independently cloned and named Angie, is an antimicrobial peptide and CXC chemokine strongly expressed in the follicles of the spleen, lymph nodes, and Peyer's patches. It preferentially promotes the migration of B lymphocytes (compared to T cells and macrophages), apparently by stimulating calcium influx into, and chemotaxis of, cells expressing Burkitt's lymphoma receptor 1 (BLR-1). It may therefore function in the homing of B lymphocytes to follicles. [provided by RefSeq, Oct 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.