Human PPIA/CYPA/CYPH ORF/cDNA clone-Lentivirus particle (NM_021130.5)

SKU: vGMLV002304
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PPIA/CYPA/CYPH Lentiviral expression plasmid for PPIA lentivirus packaging, PPIA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to PPIA/CYPA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV002304 Human PPIA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV002304
Gene Name PPIA
Accession Number NM_021130.5
Gene ID 5478
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 498 bp
Gene Alias CYPA,CYPH,HEL-S-69p
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGTCAACCCCACCGTGTTCTTCGACATTGCCGTCGACGGCGAGCCCTTGGGCCGCGTCTCCTTTGAGCTGTTTGCAGACAAGGTCCCAAAGACAGCAGAAAATTTTCGTGCTCTGAGCACTGGAGAGAAAGGATTTGGTTATAAGGGTTCCTGCTTTCACAGAATTATTCCAGGGTTTATGTGTCAGGGTGGTGACTTCACACGCCATAATGGCACTGGTGGCAAGTCCATCTATGGGGAGAAATTTGAAGATGAGAACTTCATCCTAAAGCATACGGGTCCTGGCATCTTGTCCATGGCAAATGCTGGACCCAACACAAATGGTTCCCAGTTTTTCATCTGCACTGCCAAGACTGAGTGGTTGGATGGCAAGCATGTGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47081-Ab Anti-PPIA/ CYPA/ CYPH functional antibody
    Target Antigen GM-Tg-g-T47081-Ag PPIA protein
    ORF Viral Vector pGMLV002304 Human PPIA Lentivirus plasmid
    ORF Viral Vector pGMLV002305 Human PPIA Lentivirus plasmid
    ORF Viral Vector pGMAD001436 Human PPIA Adenovirus plasmid
    ORF Viral Vector pGMAD001443 Human PPIA Adenovirus plasmid
    ORF Viral Vector pGMAP000039 Human PPIA Adenovirus plasmid
    ORF Viral Vector vGMLV002304 Human PPIA Lentivirus particle
    ORF Viral Vector vGMLV002305 Human PPIA Lentivirus particle
    ORF Viral Vector vGMAD001436 Human PPIA Adenovirus particle
    ORF Viral Vector vGMAD001443 Human PPIA Adenovirus particle
    ORF Viral Vector vGMAP000039 Human PPIA Adenovirus particle


    Target information

    Target ID GM-T47081
    Target Name PPIA
    Gene ID 5478, 268373, 574102, 25518, 493966, 608151, 281418, 100052020
    Gene Symbol and Synonyms Cphn,CYCA,CyP-18,CyP-A,CYPA,CYPH,HEL-S-69p,MT-ND1,MTND1,NADH1,ND1,p1B15,p31,PPIA,SP18
    Uniprot Accession P62937
    Uniprot Entry Name PPIA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000196262
    Target Classification Not Available

    This gene encodes a member of the peptidyl-prolyl cis-trans isomerase (PPIase) family. PPIases catalyze the cis-trans isomerization of proline imidic peptide bonds in oligopeptides and accelerate the folding of proteins. The encoded protein is a cyclosporin binding-protein and may play a role in cyclosporin A-mediated immunosuppression. The protein can also interact with several HIV proteins, including p55 gag, Vpr, and capsid protein, and has been shown to be necessary for the formation of infectious HIV virions. Multiple pseudogenes that map to different chromosomes have been reported. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.