Human STC2/STC-2/STCRP ORF/cDNA clone-Lentivirus particle (NM_003714)

Cat. No.: vGMLV001999

Pre-made Human STC2/STC-2/STCRP Lentiviral expression plasmid for STC2 lentivirus packaging, STC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to STC2/STC-2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001999 Human STC2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001999
Gene Name STC2
Accession Number NM_003714
Gene ID 8614
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 909 bp
Gene Alias STC-2,STCRP
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTGTGCCGAGCGGCTGGGCCAGTTCATGACCCTGGCTTTGGTGTTGGCCACCTTTGACCCGGCGCGGGGGACCGACGCCACCAACCCACCCGAGGGTCCCCAAGACAGGAGCTCCCAGCAGAAAGGCCGCCTGTCCCTGCAGAATACAGCGGAGATCCAGCACTGTTTGGTCAACGCTGGCGATGTGGGGTGTGGCGTGTTTGAATGTTTCGAGAACAACTCTTGTGAGATTCGGGGCTTACATGGGATTTGCATGACTTTTCTGCACAACGCTGGAAAATTTGATGCCCAGGGCAAGTCATTCATCAAAGACGCCTTGAAATGTAAGGCCCACGCTCTGCGGCACAGGTTCGGCTGCATAAGCCGGAAGTGCCCGGCCATCAGGGAAATGGTGTCCCAGTTGCAGCGGGAATGCTACCTCAAGCACGACCTGTGCGCGGCTGCCCAGGAGAACACCCGGGTGATAGTGGAGATGATCCATTTCAAGGACTTGCTGCTGCACGAACCCTACGTGGACCTCGTGAACTTGCTGCTGACCTGTGGGGAGGAGGTGAAGGAGGCCATCACCCACAGCGTGCAGGTTCAGTGTGAGCAGAACTGGGGAAGCCTGTGCTCCATCTTGAGCTTCTGCACCTCGGCCATCCAGAAGCCTCCCACGGCGCCCCCCGAGCGCCAGCCCCAGGTGGACAGAACCAAGCTCTCCAGGGCCCACCACGGGGAAGCAGGACATCACCTCCCAGAGCCCAGCAGTAGGGAGACTGGCCGAGGTGCCAAGGGTGAGCGAGGTAGCAAGAGCCACCCAAACGCCCATGCCCGAGGCAGAGTCGGGGGCCTTGGGGCTCAGGGACCTTCCGGAAGCAGCGAGTGGGAAGACGAACAGTCTGAGTATTCTGATATCCGGAGGTGA
ORF Protein Sequence MCAERLGQFMTLALVLATFDPARGTDATNPPEGPQDRSSQQKGRLSLQNTAEIQHCLVNAGDVGCGVFECFENNSCEIRGLHGICMTFLHNAGKFDAQGKSFIKDALKCKAHALRHRFGCISRKCPAIREMVSQLQRECYLKHDLCAAAQENTRVIVEMIHFKDLLLHEPYVDLVNLLLTCGEEVKEAITHSVQVQCEQNWGSLCSILSFCTSAIQKPPTAPPERQPQVDRTKLSRAHHGEAGHHLPEPSSRETGRGAKGERGSKSHPNAHARGRVGGLGAQGPSGSSEWEDEQSEYSDIRR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T58548-Ab Anti-STC2/ STC-2/ STCRP functional antibody
    Target Antigen GM-Tg-g-T58548-Ag STC2 protein
    ORF Viral Vector pGMLP002699 Human STC2 Lentivirus plasmid
    ORF Viral Vector pGMLV001999 Human STC2 Lentivirus plasmid
    ORF Viral Vector vGMLP002699 Human STC2 Lentivirus particle
    ORF Viral Vector vGMLV001999 Human STC2 Lentivirus particle


    Target information

    Target ID GM-T58548
    Target Name STC2
    Gene ID 8614, 20856, 703900, 63878, 101090485, 489112, 540573, 100058954
    Gene Symbol and Synonyms mustc2,STC-2,STC2,Stc2l,STCRP
    Uniprot Accession O76061
    Uniprot Entry Name STC2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000113739
    Target Classification Not Available

    This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.