Human STC2/STC-2/STCRP ORF/cDNA clone-Lentivirus plasmid (NM_003714)
Cat. No.: pGMLP002699
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human STC2/STC-2/STCRP Lentiviral expression plasmid for STC2 lentivirus packaging, STC2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
STC2/STC-2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLP002699 |
Gene Name | STC2 |
Accession Number | NM_003714 |
Gene ID | 8614 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 909 bp |
Gene Alias | STC-2,STCRP |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGTGTGCCGAGCGGCTGGGCCAGTTCATGACCCTGGCTTTGGTGTTGGCCACCTTTGACCCGGCGCGGGGGACCGACGCCACCAACCCACCCGAGGGTCCCCAAGACAGGAGCTCCCAGCAGAAAGGCCGCCTGTCCCTGCAGAATACAGCGGAGATCCAGCACTGTTTGGTCAACGCTGGCGATGTGGGGTGTGGCGTGTTTGAATGTTTCGAGAACAACTCTTGTGAGATTCGGGGCTTACATGGGATTTGCATGACTTTTCTGCACAACGCTGGAAAATTTGATGCCCAGGGCAAGTCATTCATCAAAGACGCCTTGAAATGTAAGGCCCACGCTCTGCGGCACAGGTTCGGCTGCATAAGCCGGAAGTGCCCGGCCATCAGGGAAATGGTGTCCCAGTTGCAGCGGGAATGCTACCTCAAGCACGACCTGTGCGCGGCTGCCCAGGAGAACACCCGGGTGATAGTGGAGATGATCCATTTCAAGGACTTGCTGCTGCACGAACCCTACGTGGACCTCGTGAACTTGCTGCTGACCTGTGGGGAGGAGGTGAAGGAGGCCATCACCCACAGCGTGCAGGTTCAGTGTGAGCAGAACTGGGGAAGCCTGTGCTCCATCTTGAGCTTCTGCACCTCGGCCATCCAGAAGCCTCCCACGGCGCCCCCCGAGCGCCAGCCCCAGGTGGACAGAACCAAGCTCTCCAGGGCCCACCACGGGGAAGCAGGACATCACCTCCCAGAGCCCAGCAGTAGGGAGACTGGCCGAGGTGCCAAGGGTGAGCGAGGTAGCAAGAGCCACCCAAACGCCCATGCCCGAGGCAGAGTCGGGGGCCTTGGGGCTCAGGGACCTTCCGGAAGCAGCGAGTGGGAAGACGAACAGTCTGAGTATTCTGATATCCGGAGGTGA |
ORF Protein Sequence | MCAERLGQFMTLALVLATFDPARGTDATNPPEGPQDRSSQQKGRLSLQNTAEIQHCLVNAGDVGCGVFECFENNSCEIRGLHGICMTFLHNAGKFDAQGKSFIKDALKCKAHALRHRFGCISRKCPAIREMVSQLQRECYLKHDLCAAAQENTRVIVEMIHFKDLLLHEPYVDLVNLLLTCGEEVKEAITHSVQVQCEQNWGSLCSILSFCTSAIQKPPTAPPERQPQVDRTKLSRAHHGEAGHHLPEPSSRETGRGAKGERGSKSHPNAHARGRVGGLGAQGPSGSSEWEDEQSEYSDIRR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T58548-Ab | Anti-STC2/ STC-2/ STCRP functional antibody |
Target Antigen | GM-Tg-g-T58548-Ag | STC2 protein |
ORF Viral Vector | pGMLP002699 | Human STC2 Lentivirus plasmid |
ORF Viral Vector | pGMLV001999 | Human STC2 Lentivirus plasmid |
ORF Viral Vector | vGMLP002699 | Human STC2 Lentivirus particle |
ORF Viral Vector | vGMLV001999 | Human STC2 Lentivirus particle |
Target information
Target ID | GM-T58548 |
Target Name | STC2 |
Gene ID | 8614, 20856, 703900, 63878, 101090485, 489112, 540573, 100058954 |
Gene Symbol and Synonyms | mustc2,STC-2,STC2,Stc2l,STCRP |
Uniprot Accession | O76061 |
Uniprot Entry Name | STC2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000113739 |
Target Classification | Not Available |
This gene encodes a secreted, homodimeric glycoprotein that is expressed in a wide variety of tissues and may have autocrine or paracrine functions. The encoded protein has 10 of its 15 cysteine residues conserved among stanniocalcin family members and is phosphorylated by casein kinase 2 exclusively on its serine residues. Its C-terminus contains a cluster of histidine residues which may interact with metal ions. The protein may play a role in the regulation of renal and intestinal calcium and phosphate transport, cell metabolism, or cellular calcium/phosphate homeostasis. Constitutive overexpression of human stanniocalcin 2 in mice resulted in pre- and postnatal growth restriction, reduced bone and skeletal muscle growth, and organomegaly. Expression of this gene is induced by estrogen and altered in some breast cancers. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.