Human CCL2/GDCF-2/ HC11 ORF/cDNA clone-Lentivirus particle (NM_002982.4)

Pre-made Human CCL2/GDCF-2/ HC11 Lentiviral expression plasmid for CCL2 lentivirus packaging, CCL2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to CCL2/GDCF-2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001954 Human CCL2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001954
Gene Name CCL2
Accession Number NM_002982.4
Gene ID 6347
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 300 bp
Gene Alias GDCF-2, HC11, HSMCR30, MCAF, MCP-1, MCP1, SCYA2, SMC-CF
Fluorescent Reporter Luciferase
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAAGTCTCTGCCGCCCTTCTGTGCCTGCTGCTCATAGCAGCCACCTTCATTCCCCAAGGGCTCGCTCAGCCAGATGCAATCAATGCCCCAGTCACCTGCTGTTATAACTTCACCAATAGGAAGATCTCAGTGCAGAGGCTCGCGAGCTATAGAAGAATCACCAGCAGCAAGTGTCCCAAAGAAGCTGTGATCTTCAAGACCATTGTGGCCAAGGAGATCTGTGCTGACCCCAAGCAGAAGTGGGTTCAGGATTCCATGGACCACCTGGACAAGCAAACCCAAACTCCGAAGACTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-094 Pre-Made Carlumab biosimilar, Whole mAb, Anti-CCL2 Antibody: Anti-HC11/MCAF/MCP1/MCP-1/SCYA2/GDCF-2/SMC-CF/HSMCR30 therapeutic antibody
    Target Antibody GM-Tg-g-T11309-Ab Anti-CCL2/ GDCF-2/ HC11 functional antibody
    Target Antigen GM-Tg-g-T11309-Ag CCL2 protein
    Cytokine cks-Tg-g-GM-T11309 chemokine (C-C motif) ligand 2 (CCL2) protein & antibody
    ORF Viral Vector pGMLV001561 Human CCL2 Lentivirus plasmid
    ORF Viral Vector pGMLV001954 Human CCL2 Lentivirus plasmid
    ORF Viral Vector pGMLP000392 Human CCL2 Lentivirus plasmid
    ORF Viral Vector pGMAP000030 Human CCL2 Adenovirus plasmid
    ORF Viral Vector vGMLV001561 Human CCL2 Lentivirus particle
    ORF Viral Vector vGMLV001954 Human CCL2 Lentivirus particle
    ORF Viral Vector vGMLP000392 Human CCL2 Lentivirus particle
    ORF Viral Vector vGMAP000030 Human CCL2 Adenovirus particle


    Target information

    Target ID GM-T11309
    Target Name CCL2
    Gene ID 6347, 20296, 574138
    Gene Symbol and Synonyms CCL2,GDCF-2,HC11,HSMCR30,JE,MCAF,MCP-1,MCP1,SCYA2,Sigje,SMC-CF
    Uniprot Accession P13500
    Uniprot Entry Name CCL2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Breast Cancer, Systemic lupus erythematosus (SLE), Idiopathic hypoparathyroidism, IgA glomerulonephritis, Lupus Glomerulonephritis, Nephrotic syndrome, Nephrotic syndrome with focal and segmental glomerular lesions, Overactive bladder, Proteinuria, Renal fibrosis, Schistosomiasis, Tubulo-interstitial nephropathy in systemic lupus erythematosus, Urolithiasis, Vasculitis, Autosomal Dominant Polycystic Kidney Disease, Bacterial sepsis of newborn, Chronic Kidney Disease, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Diabetic Nephropathy, Glomerulonephritis, Hepatic fibrosis, Hydronephrosis with renal and ureteral calculous obstruction, Hypertension, Type 2 diabetes mellitus with diabetic nephropathy, breast cancer
    Gene Ensembl ENSG00000108691
    Target Classification Checkpoint-Immuno Oncology

    This gene is one of several cytokine genes clustered on the q-arm of chromosome 17. Chemokines are a superfamily of secreted proteins involved in immunoregulatory and inflammatory processes. The superfamily is divided into four subfamilies based on the arrangement of N-terminal cysteine residues of the mature peptide. This chemokine is a member of the CC subfamily which is characterized by two adjacent cysteine residues. This cytokine displays chemotactic activity for monocytes and basophils but not for neutrophils or eosinophils. It has been implicated in the pathogenesis of diseases characterized by monocytic infiltrates, like psoriasis, rheumatoid arthritis and atherosclerosis. It binds to chemokine receptors CCR2 and CCR4. Elevated expression of the encoded protein is associated with severe acute respiratory syndrome coronavirus 2 (SARS‐CoV‐2) infection. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.