Human TRAF6/MGC:3310/RNF85 ORF/cDNA clone-Lentivirus particle (NM_145803)
SKU: vGMLV001820
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TRAF6/MGC:3310/RNF85 Lentiviral expression plasmid for TRAF6 lentivirus packaging, TRAF6 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
TRAF6/MGC:3310 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001820 | Human TRAF6 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001820 |
Gene Name | TRAF6 |
Accession Number | NM_145803 |
Gene ID | 7189 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1569 bp |
Gene Alias | MGC:3310,RNF85 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGATGCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATGGATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAGGATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGATAAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACTATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATTCCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGCCACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCCACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCAGGGGTATAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T15051-Ab | Anti-TRAF6 monoclonal antibody |
Target Antigen | GM-Tg-g-T15051-Ag | TRAF6 protein |
Cytokine | cks-Tg-g-GM-T15051 | TNF receptor-associated factor 6, E3 ubiquitin protein ligase (TRAF6) protein & antibody |
ORF Viral Vector | pGMLP001351 | Human TRAF6 Lentivirus plasmid |
ORF Viral Vector | pGMLV001820 | Human TRAF6 Lentivirus plasmid |
ORF Viral Vector | pGMPC001026 | Human TRAF6 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001068 | Human TRAF6 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP001351 | Human TRAF6 Lentivirus particle |
ORF Viral Vector | vGMLV001820 | Human TRAF6 Lentivirus particle |
Target information
Target ID | GM-T15051 |
Target Name | TRAF6 |
Gene ID | 7189, 22034, 716907, 311245, 101099750, 100688110, 539124, 100052296 |
Gene Symbol and Synonyms | 2310003F17Rik,C630032O20Rik,MGC:3310,RNF85,TRAF6 |
Uniprot Accession | Q9Y4K3 |
Uniprot Entry Name | TRAF6_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000175104 |
Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain and mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. The protein encoded by this gene is a key molecule in antiviral innate and antigen-specific immune responses. [provided by RefSeq, Nov 2021]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.