Human TRAF6/MGC:3310/RNF85 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_145803.3)

Cat. No.: pGMPC001068
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TRAF6/MGC:3310/RNF85 Non-Viral expression plasmid (overexpression vector) for mouse TRAF6 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to TRAF6/MGC:3310 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC001068
Gene Name TRAF6
Accession Number NM_145803.3
Gene ID 7189
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1569 bp
Gene Alias MGC:3310,RNF85
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag MYC (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGTCTGCTAAACTGTGAAAACAGCTGTGGATCCAGCCAGTCTGAAAGTGACTGCTGTGTGGCCATGGCCAGCTCCTGTAGCGCTGTAACAAAAGATGATAGTGTGGGTGGAACTGCCAGCACGGGGAACCTCTCCAGCTCATTTATGGAGGAGATCCAGGGATATGATGTAGAGTTTGACCCACCCCTGGAAAGCAAGTATGAATGCCCCATCTGCTTGATGGCATTACGAGAAGCAGTGCAAACGCCATGCGGCCATAGGTTCTGCAAAGCCTGCATCATAAAATCAATAAGGGATGCAGGTCACAAATGTCCAGTTGACAATGAAATACTGCTGGAAAATCAACTATTTCCAGACAATTTTGCAAAACGTGAGATTCTTTCTCTGATGGTGAAATGTCCAAATGAAGGTTGTTTGCACAAGATGGAACTGAGACATCTTGAGGATCATCAAGCACATTGTGAGTTTGCTCTTATGGATTGTCCCCAATGCCAGCGTCCCTTCCAAAAATTCCATATTAATATTCACATTCTGAAGGATTGTCCAAGGAGACAGGTTTCTTGTGACAACTGTGCTGCATCAATGGCATTTGAAGATAAAGAGATCCATGACCAGAACTGTCCTTTGGCAAATGTCATCTGTGAATACTGCAATACTATACTCATCAGAGAACAGATGCCTAATCATTATGATCTAGACTGCCCTACAGCCCCAATTCCATGCACATTCAGTACTTTTGGTTGCCATGAAAAGATGCAGAGGAATCACTTGGCACGCCACCTACAAGAGAACACCCAGTCACACATGAGAATGTTGGCCCAGGCTGTTCATAGTTTGAGCGTTATACCCGACTCTGGGTATATCTCAGAGGTCCGGAATTTCCAGGAAACTATTCACCAGTTAGAGGGTCGCCTTGTAAGACAAGACCATCAAATCCGGGAGCTGACTGCTAAAATGGAAACTCAGAGTATGTATGTAAGTGAGCTCAAACGAACCATTCGAACCCTTGAGGACAAAGTTGCTGAAATCGAAGCACAGCAGTGCAATGGAATTTATATTTGGAAGATTGGCAACTTTGGAATGCATTTGAAATGTCAAGAAGAGGAGAAACCTGTTGTGATTCATAGCCCTGGATTCTACACTGGCAAACCCGGGTACAAACTGTGCATGCGCTTGCACCTTCAGTTACCGACTGCTCAGCGCTGTGCAAACTATATATCCCTTTTTGTCCACACAATGCAAGGAGAATATGACAGCCACCTCCCTTGGCCCTTCCAGGGTACAATACGCCTTACAATTCTTGATCAGTCTGAAGCACCTGTAAGGCAAAACCACGAAGAGATAATGGATGCCAAACCAGAGCTGCTTGCTTTCCAGCGACCCACAATCCCACGGAACCCAAAAGGTTTTGGCTATGTAACTTTTATGCATCTGGAAGCCCTAAGACAAAGAACTTTCATTAAGGATGACACATTATTAGTGCGCTGTGAGGTCTCCACCCGCTTTGACATGGGTAGCCTTCGGAGGGAGGGTTTTCAGCCACGAAGTACTGATGCAGGGGTATAG
ORF Protein Sequence MSLLNCENSCGSSQSESDCCVAMASSCSAVTKDDSVGGTASTGNLSSSFMEEIQGYDVEFDPPLESKYECPICLMALREAVQTPCGHRFCKACIIKSIRDAGHKCPVDNEILLENQLFPDNFAKREILSLMVKCPNEGCLHKMELRHLEDHQAHCEFALMDCPQCQRPFQKFHINIHILKDCPRRQVSCDNCAASMAFEDKEIHDQNCPLANVICEYCNTILIREQMPNHYDLDCPTAPIPCTFSTFGCHEKMQRNHLARHLQENTQSHMRMLAQAVHSLSVIPDSGYISEVRNFQETIHQLEGRLVRQDHQIRELTAKMETQSMYVSELKRTIRTLEDKVAEIEAQQCNGIYIWKIGNFGMHLKCQEEEKPVVIHSPGFYTGKPGYKLCMRLHLQLPTAQRCANYISLFVHTMQGEYDSHLPWPFQGTIRLTILDQSEAPVRQNHEEIMDAKPELLAFQRPTIPRNPKGFGYVTFMHLEALRQRTFIKDDTLLVRCEVSTRFDMGSLRREGFQPRSTDAGV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15051-Ab Anti-TRAF6 monoclonal antibody
    Target Antigen GM-Tg-g-T15051-Ag TRAF6 protein
    Cytokine cks-Tg-g-GM-T15051 TNF receptor-associated factor 6, E3 ubiquitin protein ligase (TRAF6) protein & antibody
    ORF Viral Vector pGMLP001351 Human TRAF6 Lentivirus plasmid
    ORF Viral Vector pGMLV001820 Human TRAF6 Lentivirus plasmid
    ORF Viral Vector pGMPC001026 Human TRAF6 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001068 Human TRAF6 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP001351 Human TRAF6 Lentivirus particle
    ORF Viral Vector vGMLV001820 Human TRAF6 Lentivirus particle


    Target information

    Target ID GM-T15051
    Target Name TRAF6
    Gene ID 7189, 22034, 716907, 311245, 101099750, 100688110, 539124, 100052296
    Gene Symbol and Synonyms 2310003F17Rik,C630032O20Rik,MGC:3310,RNF85,TRAF6
    Uniprot Accession Q9Y4K3
    Uniprot Entry Name TRAF6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Cytokine Target
    Disease Cancer
    Gene Ensembl ENSG00000175104
    Target Classification Tumor-associated antigen (TAA)

    The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain and mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. The protein encoded by this gene is a key molecule in antiviral innate and antigen-specific immune responses. [provided by RefSeq, Nov 2021]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.