Human EBI3/IL-27B/ IL27B ORF/cDNA clone-Lentivirus particle (NM_005755.3)

Pre-made Human EBI3/IL-27B/ IL27B Lentiviral expression plasmid for EBI3 lentivirus packaging, EBI3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to IL35/EBI3/IL-27B products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001553 Human EBI3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001553
Gene Name EBI3
Accession Number NM_005755.3
Gene ID 10148
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 690 bp
Gene Alias IL-27B, IL27B, IL35B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCCCGCAGCTTCTCCTGGCCCTTGTCCTCTGGGCCAGCTGCCCGCCCTGCAGTGGAAGGAAAGGGCCCCCAGCAGCTCTGACACTGCCCCGGGTGCAATGCCGAGCCTCTCGGTACCCGATCGCCGTGGATTGCTCCTGGACCCTGCCGCCTGCTCCAAACTCCACCAGCCCCGTGTCCTTCATTGCCACGTACAGGCTCGGCATGGCTGCCCGGGGCCACAGCTGGCCCTGCCTGCAGCAGACGCCAACGTCCACCAGCTGCACCATCACGGATGTCCAGCTGTTCTCCATGGCTCCCTACGTGCTCAATGTCACCGCCGTCCACCCCTGGGGCTCCAGCAGCAGCTTCGTGCCTTTCATAACAGAGCACATCATCAAGCCCGACCCTCCAGAAGGCGTGCGCCTAAGCCCCCTCGCTGAGCGCCAGCTACAGGTGCAGTGGGAGCCTCCCGGGTCCTGGCCCTTCCCAGAGATCTTCTCACTGAAGTACTGGATCCGTTACAAGCGTCAGGGAGCTGCGCGCTTCCACCGGGTGGGGCCCATTGAAGCCACGTCCTTCATCCTCAGGGCTGTGCGGCCCCGAGCCAGGTACTACGTCCAAGTGGCGGCTCAGGACCTCACAGACTACGGGGAACTGAGTGACTGGAGTCTCCCCGCCACTGCCACAATGAGCCTGGGCAAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02231-Ab Anti-IL27B/ IL35/ EBI3 monoclonal antibody
    Target Antigen GM-Tg-g-T02231-Ag IL35/EBI3 VLP (virus-like particle)
    ORF Viral Vector pGMLV000206 Human EBI3 Lentivirus plasmid
    ORF Viral Vector pGMLV001553 Human EBI3 Lentivirus plasmid
    ORF Viral Vector vGMLV000206 Human EBI3 Lentivirus particle
    ORF Viral Vector vGMLV001553 Human EBI3 Lentivirus particle


    Target information

    Target ID GM-T02231
    Target Name IL35
    Gene ID 10148, 50498, 721832, 680609, 101101032, 485043, 514933, 100063061
    Gene Symbol and Synonyms EBI-3,EBI3,IL-27,IL-27B,IL27B,IL35B
    Uniprot Accession Q14213
    Uniprot Entry Name IL27B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Not Available
    Gene Ensembl ENSG00000105246
    Target Classification Checkpoint-Immuno Oncology

    This gene was identified by its induced expression in B lymphocytes in response Epstein-Barr virus infection. It encodes a secreted glycoprotein belonging to the hematopoietin receptor family, and heterodimerizes with a 28 kDa protein to form interleukin 27 (IL-27). IL-27 regulates T cell and inflammatory responses, in part by activating the Jak/STAT pathway of CD4+ T cells. [provided by RefSeq, Sep 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.