Human EBI3/IL-27B/ IL27B ORF/cDNA clone-Lentivirus plasmid (NM_005755.3)
Pre-made Human EBI3/IL-27B/ IL27B Lentiviral expression plasmid for EBI3 lentivirus packaging, EBI3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to IL35/EBI3/IL-27B products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001553 | Human EBI3 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001553 |
Gene Name | EBI3 |
Accession Number | NM_005755.3 |
Gene ID | 10148 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 690 bp |
Gene Alias | IL-27B, IL27B, IL35B |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGACCCCGCAGCTTCTCCTGGCCCTTGTCCTCTGGGCCAGCTGCCCGCCCTGCAGTGGAAGGAAAGGGCCCCCAGCAGCTCTGACACTGCCCCGGGTGCAATGCCGAGCCTCTCGGTACCCGATCGCCGTGGATTGCTCCTGGACCCTGCCGCCTGCTCCAAACTCCACCAGCCCCGTGTCCTTCATTGCCACGTACAGGCTCGGCATGGCTGCCCGGGGCCACAGCTGGCCCTGCCTGCAGCAGACGCCAACGTCCACCAGCTGCACCATCACGGATGTCCAGCTGTTCTCCATGGCTCCCTACGTGCTCAATGTCACCGCCGTCCACCCCTGGGGCTCCAGCAGCAGCTTCGTGCCTTTCATAACAGAGCACATCATCAAGCCCGACCCTCCAGAAGGCGTGCGCCTAAGCCCCCTCGCTGAGCGCCAGCTACAGGTGCAGTGGGAGCCTCCCGGGTCCTGGCCCTTCCCAGAGATCTTCTCACTGAAGTACTGGATCCGTTACAAGCGTCAGGGAGCTGCGCGCTTCCACCGGGTGGGGCCCATTGAAGCCACGTCCTTCATCCTCAGGGCTGTGCGGCCCCGAGCCAGGTACTACGTCCAAGTGGCGGCTCAGGACCTCACAGACTACGGGGAACTGAGTGACTGGAGTCTCCCCGCCACTGCCACAATGAGCCTGGGCAAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T02231-Ab | Anti-IL27B/ IL35/ EBI3 monoclonal antibody |
Target Antigen | GM-Tg-g-T02231-Ag | IL35/EBI3 VLP (virus-like particle) |
ORF Viral Vector | pGMLV000206 | Human EBI3 Lentivirus plasmid |
ORF Viral Vector | pGMLV001553 | Human EBI3 Lentivirus plasmid |
ORF Viral Vector | vGMLV000206 | Human EBI3 Lentivirus particle |
ORF Viral Vector | vGMLV001553 | Human EBI3 Lentivirus particle |
Target information
Target ID | GM-T02231 |
Target Name | IL35 |
Gene ID | 10148, 50498, 721832, 680609, 101101032, 485043, 514933, 100063061 |
Gene Symbol and Synonyms | EBI-3,EBI3,IL-27,IL-27B,IL27B,IL35B |
Uniprot Accession | Q14213 |
Uniprot Entry Name | IL27B_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Not Available |
Gene Ensembl | ENSG00000105246 |
Target Classification | Checkpoint-Immuno Oncology |
This gene was identified by its induced expression in B lymphocytes in response Epstein-Barr virus infection. It encodes a secreted glycoprotein belonging to the hematopoietin receptor family, and heterodimerizes with a 28 kDa protein to form interleukin 27 (IL-27). IL-27 regulates T cell and inflammatory responses, in part by activating the Jak/STAT pathway of CD4+ T cells. [provided by RefSeq, Sep 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.