Human LCN2/24p3/MSFI ORF/cDNA clone-Lentivirus particle (NM_005564)
SKU: vGMLV001321
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human LCN2/24p3/MSFI Lentiviral expression plasmid for LCN2 lentivirus packaging, LCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
LCN2/24p3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001321 | Human LCN2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001321 |
Gene Name | LCN2 |
Accession Number | NM_005564 |
Gene ID | 3934 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 597 bp |
Gene Alias | 24p3,MSFI,NGAL,p25 |
Fluorescent Reporter | Firefly luciferase |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCCCTAGGTCTCCTGTGGCTGGGCCTAGCCCTGTTGGGGGCTCTGCATGCCCAGGCCCAGGACTCCACCTCAGACCTGATCCCAGCCCCACCTCTGAGCAAGGTCCCTCTGCAGCAGAACTTCCAGGACAACCAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTCCCAATCGACCAGTGTATCGACGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T72010-Ab | Anti-NGAL/ LCN2/ 24p3 functional antibody |
Target Antigen | GM-Tg-g-T72010-Ag | LCN2 protein |
ORF Viral Vector | pGMLP002859 | Human LCN2 Lentivirus plasmid |
ORF Viral Vector | pGMLV001321 | Human LCN2 Lentivirus plasmid |
ORF Viral Vector | pGMAD001066 | Human LCN2 Adenovirus plasmid |
ORF Viral Vector | pGMPC000637 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000792 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001300 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001766 | Human LCN2 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLP002859 | Human LCN2 Lentivirus particle |
ORF Viral Vector | vGMLV001321 | Human LCN2 Lentivirus particle |
ORF Viral Vector | vGMAD001066 | Human LCN2 Adenovirus particle |
Target information
Target ID | GM-T72010 |
Target Name | LCN2 |
Gene ID | 3934, 16819, 697208, 170496, 491320, 526639, 100070310 |
Gene Symbol and Synonyms | 24p3,LCN2,MSFI,NGAL,NRL,p25,Sip24 |
Uniprot Accession | P80188 |
Uniprot Entry Name | NGAL_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Diagnostics Biomarker |
Disease | Prostate Cancer, Complications of kidney transplant, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to hazardous aromatic compounds, Contrast - Induced Nephropathy, Delayed Graft Function, Dent disease, Diabetic Nephropathy, HIV-Associated Nephropathy, Hydronephrosis, Hypertension, Impaired renal function disease, Injury to Kidney, Intraoperative Renal Injury, Kidney transplant rejection, Lupus Glomerulonephritis, Neonatal urinary tract infection, Nephrectomy, Nephropathy induced by other drugs, medicaments and biological substances, Nephrotic syndrome, Nephrotic syndrome with diffuse membranous glomerulonephritis, Proteinuria, Renal fibrosis, Renovascular hypertension, Sepsis due to Enterococcus, Systemic inflammatory response syndrome (SIRS) of non-infectious origin with acute organ dysfunction, Systemic lupus erythematosus (SLE), Transplanted Heart Complication, Type 1 diabetes mellitus with diabetic nephropathy, Acute pancreatitis, Asphyxia neonatorum, Autosomal Dominant Polycystic Kidney Disease, Cardiogenic shock, Chronic Kidney Disease, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux |
Gene Ensembl | ENSG00000148346 |
Target Classification | Not Available |
This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.