Human LCN2/24p3/MSFI ORF/cDNA clone-Lentivirus plasmid (NM_005564)

SKU: pGMLP002859
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LCN2/24p3/MSFI Lentiviral expression plasmid for LCN2 lentivirus packaging, LCN2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LCN2/24p3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $449.25
Shipping fee: Limited-time free


Product Description

Catalog ID pGMLP002859
Gene Name LCN2
Accession Number NM_005564
Gene ID 3934
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 597 bp
Gene Alias 24p3,MSFI,NGAL,p25
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCCCTAGGTCTCCTGTGGCTGGGCCTAGCCCTGTTGGGGGCTCTGCATGCCCAGGCCCAGGACTCCACCTCAGACCTGATCCCAGCCCCACCTCTGAGCAAGGTCCCTCTGCAGCAGAACTTCCAGGACAACCAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTCCCAATCGACCAGTGTATCGACGGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T72010-Ab Anti-NGAL/ LCN2/ 24p3 functional antibody
    Target Antigen GM-Tg-g-T72010-Ag LCN2 protein
    ORF Viral Vector pGMLP002859 Human LCN2 Lentivirus plasmid
    ORF Viral Vector pGMLV001321 Human LCN2 Lentivirus plasmid
    ORF Viral Vector pGMAD001066 Human LCN2 Adenovirus plasmid
    ORF Viral Vector pGMPC000637 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000792 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001300 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001766 Human LCN2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP002859 Human LCN2 Lentivirus particle
    ORF Viral Vector vGMLV001321 Human LCN2 Lentivirus particle
    ORF Viral Vector vGMAD001066 Human LCN2 Adenovirus particle


    Target information

    Target ID GM-T72010
    Target Name LCN2
    Gene ID 3934, 16819, 697208, 170496, 491320, 526639, 100070310
    Gene Symbol and Synonyms 24p3,LCN2,MSFI,NGAL,NRL,p25,Sip24
    Uniprot Accession P80188
    Uniprot Entry Name NGAL_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Prostate Cancer, Complications of kidney transplant, Congenital hydronephrosis, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to hazardous aromatic compounds, Contrast - Induced Nephropathy, Delayed Graft Function, Dent disease, Diabetic Nephropathy, HIV-Associated Nephropathy, Hydronephrosis, Hypertension, Impaired renal function disease, Injury to Kidney, Intraoperative Renal Injury, Kidney transplant rejection, Lupus Glomerulonephritis, Neonatal urinary tract infection, Nephrectomy, Nephropathy induced by other drugs, medicaments and biological substances, Nephrotic syndrome, Nephrotic syndrome with diffuse membranous glomerulonephritis, Proteinuria, Renal fibrosis, Renovascular hypertension, Sepsis due to Enterococcus, Systemic inflammatory response syndrome (SIRS) of non-infectious origin with acute organ dysfunction, Systemic lupus erythematosus (SLE), Transplanted Heart Complication, Type 1 diabetes mellitus with diabetic nephropathy, Acute pancreatitis, Asphyxia neonatorum, Autosomal Dominant Polycystic Kidney Disease, Cardiogenic shock, Chronic Kidney Disease, Type 2 diabetes mellitus, Vasculitis, Vesicoureteral reflux
    Gene Ensembl ENSG00000148346
    Target Classification Not Available

    This gene encodes a protein that belongs to the lipocalin family. Members of this family transport small hydrophobic molecules such as lipids, steroid hormones and retinoids. The protein encoded by this gene is a neutrophil gelatinase-associated lipocalin and plays a role in innate immunity by limiting bacterial growth as a result of sequestering iron-containing siderophores. The presence of this protein in blood and urine is an early biomarker of acute kidney injury. This protein is thought to be be involved in multiple cellular processes, including maintenance of skin homeostasis, and suppression of invasiveness and metastasis. Mice lacking this gene are more susceptible to bacterial infection than wild type mice. [provided by RefSeq, Sep 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.