Human IGFBP3/BP-53/IBP3 ORF/cDNA clone-Lentivirus particle (NM_000598.5)

Cat. No.: vGMLV001162

Pre-made Human IGFBP3/BP-53/IBP3 Lentiviral expression plasmid for IGFBP3 lentivirus packaging, IGFBP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to IGFBP3/BP-53 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV001162 Human IGFBP3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV001162
Gene Name IGFBP3
Accession Number NM_000598.5
Gene ID 3486
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 876 bp
Gene Alias BP-53,IBP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCAGCGGGCGCGACCCACGCTCTGGGCCGCTGCGCTGACTCTGCTGGTGCTGCTCCGCGGGCCGCCGGTGGCGCGGGCTGGCGCGAGCTCGGCGGGCTTGGGTCCCGTGGTGCGCTGCGAGCCGTGCGACGCGCGTGCACTGGCCCAGTGCGCGCCTCCGCCCGCCGTGTGCGCGGAGCTGGTGCGCGAGCCGGGCTGCGGCTGCTGCCTGACGTGCGCACTGAGCGAGGGCCAGCCGTGCGGCATCTACACCGAGCGCTGTGGCTCCGGCCTTCGCTGCCAGCCGTCGCCCGACGAGGCGCGACCGCTGCAGGCGCTGCTGGACGGCCGCGGGCTCTGCGTCAACGCTAGTGCCGTCAGCCGCCTGCGCGCCTACCTGCTGCCAGCGCCGCCAGCTCCAGGAAATGCTAGTGAGTCGGAGGAAGACCGCAGCGCCGGCAGTGTGGAGAGCCCGTCCGTCTCCAGCACGCACCGGGTGTCTGATCCCAAGTTCCACCCCCTCCATTCAAAGATAATCATCATCAAGAAAGGGCATGCTAAAGACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAG
ORF Protein Sequence MQRARPTLWAAALTLLVLLRGPPVARAGASSAGLGPVVRCEPCDARALAQCAPPPAVCAELVREPGCGCCLTCALSEGQPCGIYTERCGSGLRCQPSPDEARPLQALLDGRGLCVNASAVSRLRAYLLPAPPAPGNASESEEDRSAGSVESPSVSSTHRVSDPKFHPLHSKIIIIKKGHAKDSQRYKVDYESQSTDTQNFSSESKRETEYGPCRREMEDTLNHLKFLNVLSPRGVHIPNCDKKGFYKKKQCRPSKGRKRGFCWCVDKYGQPLPGYTTKGKEDVHCYSMQSK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T33455-Ab Anti-IBP3/ IGFBP3/ BP-53 functional antibody
    Target Antigen GM-Tg-g-T33455-Ag IGFBP3 protein
    Cytokine cks-Tg-g-GM-T33455 insulin-like growth factor binding protein 3 (IGFBP3) protein & antibody
    ORF Viral Vector pGMLP004768 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector pGMLV001162 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector pGMLV001497 Human IGFBP3 Lentivirus plasmid
    ORF Viral Vector vGMLP004768 Human IGFBP3 Lentivirus particle
    ORF Viral Vector vGMLV001162 Human IGFBP3 Lentivirus particle
    ORF Viral Vector vGMLV001497 Human IGFBP3 Lentivirus particle


    Target information

    Target ID GM-T33455
    Target Name IGFBP3
    Gene ID 3486, 16009, 696868, 24484, 101080442, 100855619, 282261, 100034155
    Gene Symbol and Synonyms BP-53,IBP3,IGF-BP3,IGFBP-3,IGFBP3,IGgfbp3
    Uniprot Accession P17936
    Uniprot Entry Name IBP3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000146674
    Target Classification Not Available

    This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.