Human IGFBP3/BP-53/IBP3 ORF/cDNA clone-Lentivirus plasmid (NM_000598.5)
Cat. No.: pGMLV001497
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IGFBP3/BP-53/IBP3 Lentiviral expression plasmid for IGFBP3 lentivirus packaging, IGFBP3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IGFBP3/BP-53 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV001497 |
Gene Name | IGFBP3 |
Accession Number | NM_000598.5 |
Gene ID | 3486 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 876 bp |
Gene Alias | BP-53,IBP3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGCAGCGGGCGCGACCCACGCTCTGGGCCGCTGCGCTGACTCTGCTGGTGCTGCTCCGCGGGCCGCCGGTGGCGCGGGCTGGCGCGAGCTCGGCGGGCTTGGGTCCCGTGGTGCGCTGCGAGCCGTGCGACGCGCGTGCACTGGCCCAGTGCGCGCCTCCGCCCGCCGTGTGCGCGGAGCTGGTGCGCGAGCCGGGCTGCGGCTGCTGCCTGACGTGCGCACTGAGCGAGGGCCAGCCGTGCGGCATCTACACCGAGCGCTGTGGCTCCGGCCTTCGCTGCCAGCCGTCGCCCGACGAGGCGCGACCGCTGCAGGCGCTGCTGGACGGCCGCGGGCTCTGCGTCAACGCTAGTGCCGTCAGCCGCCTGCGCGCCTACCTGCTGCCAGCGCCGCCAGCTCCAGGAAATGCTAGTGAGTCGGAGGAAGACCGCAGCGCCGGCAGTGTGGAGAGCCCGTCCGTCTCCAGCACGCACCGGGTGTCTGATCCCAAGTTCCACCCCCTCCATTCAAAGATAATCATCATCAAGAAAGGGCATGCTAAAGACAGCCAGCGCTACAAAGTTGACTACGAGTCTCAGAGCACAGATACCCAGAACTTCTCCTCCGAGTCCAAGCGGGAGACAGAATATGGTCCCTGCCGTAGAGAAATGGAAGACACACTGAATCACCTGAAGTTCCTCAATGTGCTGAGTCCCAGGGGTGTACACATTCCCAACTGTGACAAGAAGGGATTTTATAAGAAAAAGCAGTGTCGCCCTTCCAAAGGCAGGAAGCGGGGCTTCTGCTGGTGTGTGGATAAGTATGGGCAGCCTCTCCCAGGCTACACCACCAAGGGGAAGGAGGACGTGCACTGCTACAGCATGCAGAGCAAGTAG |
ORF Protein Sequence | MQRARPTLWAAALTLLVLLRGPPVARAGASSAGLGPVVRCEPCDARALAQCAPPPAVCAELVREPGCGCCLTCALSEGQPCGIYTERCGSGLRCQPSPDEARPLQALLDGRGLCVNASAVSRLRAYLLPAPPAPGNASESEEDRSAGSVESPSVSSTHRVSDPKFHPLHSKIIIIKKGHAKDSQRYKVDYESQSTDTQNFSSESKRETEYGPCRREMEDTLNHLKFLNVLSPRGVHIPNCDKKGFYKKKQCRPSKGRKRGFCWCVDKYGQPLPGYTTKGKEDVHCYSMQSK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T33455-Ab | Anti-IBP3/ IGFBP3/ BP-53 functional antibody |
Target Antigen | GM-Tg-g-T33455-Ag | IGFBP3 protein |
Cytokine | cks-Tg-g-GM-T33455 | insulin-like growth factor binding protein 3 (IGFBP3) protein & antibody |
ORF Viral Vector | pGMLP004768 | Human IGFBP3 Lentivirus plasmid |
ORF Viral Vector | pGMLV001162 | Human IGFBP3 Lentivirus plasmid |
ORF Viral Vector | pGMLV001497 | Human IGFBP3 Lentivirus plasmid |
ORF Viral Vector | vGMLP004768 | Human IGFBP3 Lentivirus particle |
ORF Viral Vector | vGMLV001162 | Human IGFBP3 Lentivirus particle |
ORF Viral Vector | vGMLV001497 | Human IGFBP3 Lentivirus particle |
Target information
Target ID | GM-T33455 |
Target Name | IGFBP3 |
Gene ID | 3486, 16009, 696868, 24484, 101080442, 100855619, 282261, 100034155 |
Gene Symbol and Synonyms | BP-53,IBP3,IGF-BP3,IGFBP-3,IGFBP3,IGgfbp3 |
Uniprot Accession | P17936 |
Uniprot Entry Name | IBP3_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000146674 |
Target Classification | Not Available |
This gene is a member of the insulin-like growth factor binding protein (IGFBP) family and encodes a protein with an IGFBP domain and a thyroglobulin type-I domain. The protein forms a ternary complex with insulin-like growth factor acid-labile subunit (IGFALS) and either insulin-like growth factor (IGF) I or II. In this form, it circulates in the plasma, prolonging the half-life of IGFs and altering their interaction with cell surface receptors. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.