Human IDH1/HEL-216/HEL-S-26 ORF/cDNA clone-Lentivirus particle (NM_001282386.1)
SKU: vGMLV001085
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IDH1/HEL-216/HEL-S-26 Lentiviral expression plasmid for IDH1 lentivirus packaging, IDH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IDH1/HEL-216 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001085 | Human IDH1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001085 |
Gene Name | IDH1 |
Accession Number | NM_001282386.1 |
Gene ID | 3417 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 1245 bp |
Gene Alias | HEL-216,HEL-S-26,IDCD,IDH,IDP,IDPC,PICD |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Blasticidin (BSD) |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATTGGATCTACATAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAACGACCAAGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGCATAATGTTGGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTTGAGGAGTTCAAGTTGAAACAAATGTGGAAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACGGTCTTCAGAGAAGCCATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCGTCATGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGGCCTGGAAAAGTAGAGATAACCTACACACCAAGTGACGGAACCCAAAAGGTGACATACCTGGTACATAACTTTGAAGAAGGTGGTGGTGTTGCCATGGGGATGTATAATCAAGATAAGTCAATTGAAGATTTTGCACACAGTTCCTTCCAAATGGCTCTGTCTAAGGGTTGGCCTTTGTATCTGAGCACCAAAAACACTATTCTGAAGAAATATGATGGGCGTTTTAAAGACATCTTTCAGGAGATATATGACAAGCAGTACAAGTCCCAGTTTGAAGCTCAAAAGATCTGGTATGAGCATAGGCTCATCGACGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGACTACTTGAATACATTTGAGTTCATGGATAAACTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T69563-Ab | Anti-IDH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T69563-Ag | IDH1 protein |
ORF Viral Vector | pGMLV000343 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000344 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000345 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000644 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001085 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001957 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV002527 | Human IDH1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000601 | Human IDH1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000259 | Human IDH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000260 | Human IDH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC004929 | Human IDH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000343 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV000344 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV000345 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV000644 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV001085 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV001957 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMLV002527 | Human IDH1 Lentivirus particle |
ORF Viral Vector | vGMAD000601 | Human IDH1 Adenovirus particle |
Target information
Target ID | GM-T69563 |
Target Name | IDH1 |
Gene ID | 3417, 15926, 710019, 24479, 751618, 478889, 281235, 100066416 |
Gene Symbol and Synonyms | E030024J03Rik,HEL-216,HEL-S-26,Id-1,IDCD,IDH,Idh-1,IDH1,IDP,IDPC,PICD |
Uniprot Accession | O75874 |
Uniprot Entry Name | IDHC_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Ovary Cancer |
Gene Ensembl | ENSG00000138413 |
Target Classification | Checkpoint-Immuno Oncology |
Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.