Human IDH1/HEL-216/HEL-S-26 ORF/cDNA clone-Mammalian (Non-Viral Vector) plasmid (NM_001282386.1)

Cat. No.: pGMPC000260
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IDH1/HEL-216/HEL-S-26 Non-Viral expression plasmid (overexpression vector) for mouse IDH1 overexpression in unique cell transient transfection and stable cell line development.


Target products collection

Go to IDH1/HEL-216 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMPC000260
Gene Name IDH1
Accession Number NM_001282386.1
Gene ID 3417
Species Human
Product Type Mammalian (Non-Viral Vector) plasmid (overexpression)
Insert Length 1245 bp
Gene Alias HEL-216,HEL-S-26,IDCD,IDH,IDP,IDPC,PICD
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATTGGATCTACATAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAACGACCAAGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGCATAATGTTGGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTTGAGGAGTTCAAGTTGAAACAAATGTGGAAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACGGTCTTCAGAGAAGCCATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCGTCATGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGGCCTGGAAAAGTAGAGATAACCTACACACCAAGTGACGGAACCCAAAAGGTGACATACCTGGTACATAACTTTGAAGAAGGTGGTGGTGTTGCCATGGGGATGTATAATCAAGATAAGTCAATTGAAGATTTTGCACACAGTTCCTTCCAAATGGCTCTGTCTAAGGGTTGGCCTTTGTATCTGAGCACCAAAAACACTATTCTGAAGAAATATGATGGGCGTTTTAAAGACATCTTTCAGGAGATATATGACAAGCAGTACAAGTCCCAGTTTGAAGCTCAAAAGATCTGGTATGAGCATAGGCTCATCGACGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGACTACTTGAATACATTTGAGTTCATGGATAAACTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTTTAA
ORF Protein Sequence MSKKISGGSVVEMQGDEMTRIIWELIKEKLIFPYVELDLHSYDLGIENRDATNDQVTKDAAEAIKKHNVGVKCATITPDEKRVEEFKLKQMWKSPNGTIRNILGGTVFREAIICKNIPRLVSGWVKPIIIGRHAYGDQYRATDFVVPGPGKVEITYTPSDGTQKVTYLVHNFEEGGGVAMGMYNQDKSIEDFAHSSFQMALSKGWPLYLSTKNTILKKYDGRFKDIFQEIYDKQYKSQFEAQKIWYEHRLIDDMVAQAMKSEGGFIWACKNYDGDVQSDSVAQGYGSLGMMTSVLVCPDGKTVEAEAAHGTVTRHYRMYQKGQETSTNPIASIFAWTRGLAHRAKLDNNKELAFFANALEEVSIETIEAGFMTKDLAACIKGLPNVQRSDYLNTFEFMDKLGENLKIKLAQAKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69563-Ab Anti-IDH1 monoclonal antibody
    Target Antigen GM-Tg-g-T69563-Ag IDH1 protein
    ORF Viral Vector pGMLV000343 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000344 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000345 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000644 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV001085 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV001957 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV002527 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMAD000601 Human IDH1 Adenovirus plasmid
    ORF Viral Vector pGMPC000259 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000260 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004929 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000343 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000344 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000345 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000644 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV001085 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV001957 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV002527 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMAD000601 Human IDH1 Adenovirus particle


    Target information

    Target ID GM-T69563
    Target Name IDH1
    Gene ID 3417, 15926, 710019, 24479, 751618, 478889, 281235, 100066416
    Gene Symbol and Synonyms E030024J03Rik,HEL-216,HEL-S-26,Id-1,IDCD,IDH,Idh-1,IDH1,IDP,IDPC,PICD
    Uniprot Accession O75874
    Uniprot Entry Name IDHC_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000138413
    Target Classification Checkpoint-Immuno Oncology

    Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.