Human GATA4/ASD2/TACHD ORF/cDNA clone-Lentivirus particle (NM_002052.5)

Cat. No.: vGMLV000960

Pre-made Human GATA4/ASD2/TACHD Lentiviral expression plasmid for GATA4 lentivirus packaging, GATA4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to GATA4/ASD2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000960 Human GATA4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000960
Gene Name GATA4
Accession Number NM_002052.5
Gene ID 2626
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1329 bp
Gene Alias ASD2,TACHD,TOF,VSD1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTATCAGAGCTTGGCCATGGCCGCCAACCACGGGCCGCCCCCCGGTGCCTACGAGGCGGGCGGCCCCGGCGCCTTCATGCACGGCGCGGGCGCCGCGTCCTCGCCAGTCTACGTGCCCACACCGCGGGTGCCCTCCTCCGTGCTGGGCCTGTCCTACCTCCAGGGCGGAGGCGCGGGCTCTGCGTCCGGAGGCGCCTCGGGCGGCAGCTCCGGTGGGGCCGCGTCTGGTGCGGGGCCCGGGACCCAGCAGGGCAGCCCGGGATGGAGCCAGGCGGGAGCCGACGGAGCCGCTTACACCCCGCCGCCGGTGTCGCCGCGCTTCTCCTTCCCGGGGACCACCGGGTCCCTGGCGGCCGCCGCCGCCGCTGCCGCGGCCCGGGAAGCTGCGGCCTACAGCAGTGGCGGCGGAGCGGCGGGTGCGGGCCTGGCGGGCCGCGAGCAGTACGGGCGCGCCGGCTTCGCGGGCTCCTACTCCAGCCCCTACCCGGCTTACATGGCCGACGTGGGCGCGTCCTGGGCCGCAGCCGCCGCCGCCTCCGCCGGCCCCTTCGACAGCCCGGTCCTGCACAGCCTGCCCGGCCGGGCCAACCCGGCCGCCCGACACCCCAATCTCGATATGTTTGACGACTTCTCAGAAGGCAGAGAGTGTGTCAACTGTGGGGCTATGTCCACCCCGCTCTGGAGGCGAGATGGGACGGGTCACTATCTGTGCAACGCCTGCGGCCTCTACCACAAGATGAACGGCATCAACCGGCCGCTCATCAAGCCTCAGCGCCGGCTGTCCGCCTCCCGCCGAGTGGGCCTCTCCTGTGCCAACTGCCAGACCACCACCACCACGCTGTGGCGCCGCAATGCGGAGGGCGAGCCTGTGTGCAATGCCTGCGGCCTCTACATGAAGCTCCACGGGGTCCCCAGGCCTCTTGCAATGCGGAAAGAGGGGATCCAAACCAGAAAACGGAAGCCCAAGAACCTGAATAAATCTAAGACACCAGCAGCTCCTTCAGGCAGTGAGAGCCTTCCTCCCGCCAGCGGTGCTTCCAGCAACTCCAGCAACGCCACCACCAGCAGCAGCGAGGAGATGCGTCCCATCAAGACGGAGCCTGGCCTGTCATCTCACTACGGGCACAGCAGCTCCGTGTCCCAGACGTTCTCAGTCAGTGCGATGTCTGGCCATGGGCCCTCCATCCACCCTGTCCTCTCGGCCCTGAAGCTCTCCCCACAAGGCTATGCGTCTCCCGTCAGCCAGTCTCCACAGACCAGCTCCAAGCAGGACTCTTGGAACAGCCTGGTCTTGGCCGACAGTCACGGGGACATAATCACTGCGTAA
ORF Protein Sequence MYQSLAMAANHGPPPGAYEAGGPGAFMHGAGAASSPVYVPTPRVPSSVLGLSYLQGGGAGSASGGASGGSSGGAASGAGPGTQQGSPGWSQAGADGAAYTPPPVSPRFSFPGTTGSLAAAAAAAAAREAAAYSSGGGAAGAGLAGREQYGRAGFAGSYSSPYPAYMADVGASWAAAAAASAGPFDSPVLHSLPGRANPAARHPNLDMFDDFSEGRECVNCGAMSTPLWRRDGTGHYLCNACGLYHKMNGINRPLIKPQRRLSASRRVGLSCANCQTTTTTLWRRNAEGEPVCNACGLYMKLHGVPRPLAMRKEGIQTRKRKPKNLNKSKTPAAPSGSESLPPASGASSNSSNATTSSSEEMRPIKTEPGLSSHYGHSSSVSQTFSVSAMSGHGPSIHPVLSALKLSPQGYASPVSQSPQTSSKQDSWNSLVLADSHGDIITA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T51817-Ab Anti-GATA4 monoclonal antibody
    Target Antigen GM-Tg-g-T51817-Ag GATA4 protein
    ORF Viral Vector pGMLV000960 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMLV001046 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMLV001507 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMLV002504 Human GATA4 Lentivirus plasmid
    ORF Viral Vector pGMAD000115 Human GATA4 Adenovirus plasmid
    ORF Viral Vector pGMPC000662 Human GATA4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000960 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMLV001046 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMLV001507 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMLV002504 Human GATA4 Lentivirus particle
    ORF Viral Vector vGMAD000115 Human GATA4 Adenovirus particle


    Target information

    Target ID GM-T51817
    Target Name GATA4
    Gene ID 2626, 14463, 696775, 54254, 101086140, 486079, 327716, 100065126
    Gene Symbol and Synonyms ASD2,Gata-4,GATA4,TACHD,TOF,VSD1
    Uniprot Accession P43694
    Uniprot Entry Name GATA4_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Head and Neck Cancer
    Gene Ensembl ENSG00000136574
    Target Classification Not Available

    This gene encodes a member of the GATA family of zinc-finger transcription factors. Members of this family recognize the GATA motif which is present in the promoters of many genes. This protein is thought to regulate genes involved in embryogenesis and in myocardial differentiation and function, and is necessary for normal testicular development. Mutations in this gene have been associated with cardiac septal defects. Additionally, alterations in gene expression have been associated with several cancer types. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.