Human CDK8/K35 ORF/cDNA clone-Lentivirus particle (NM_001260.3)

SKU: vGMLV000933
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CDK8/K35 Lentiviral expression plasmid for CDK8 lentivirus packaging, CDK8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.


Target products collection

Go to CDK8/K35 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000933 Human CDK8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000933
Gene Name CDK8
Accession Number NM_001260.3
Gene ID 1024
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 1395 bp
Gene Alias K35
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACTATGACTTTAAAGTGAAGCTGAGCAGCGAGCGGGAGCGGGTCGAGGACCTGTTTGAATACGAGGGCTGCAAAGTTGGCCGAGGCACTTATGGTCACGTCTACAAAGCCAAGAGGAAAGATGGGAAGGATGATAAAGACTATGCTTTAAAACAAATAGAAGGAACTGGGATCTCTATGTCGGCATGTAGAGAAATAGCATTACTTCGAGAGCTTAAGCATCCAAACGTCATTTCTCTTCAAAAGGTGTTTCTGTCTCATGCTGATAGGAAGGTGTGGCTTCTGTTTGACTATGCTGAACATGACCTCTGGCATATAATCAAGTTTCACAGAGCTTCTAAAGCAAACAAGAAGCCAGTTCAGTTACCTCGGGGAATGGTGAAGTCACTATTATATCAGATCCTAGATGGTATTCACTACCTGCATGCTAACTGGGTGTTGCACAGAGATTTGAAACCTGCTAATATTTTAGTTATGGGTGAAGGTCCTGAGCGAGGAAGAGTAAAAATTGCTGACATGGGCTTTGCCCGATTATTTAATTCACCTTTGAAGCCTTTAGCAGATTTGGATCCAGTGGTTGTTACATTCTGGTACCGAGCCCCTGAACTACTTCTTGGAGCAAGGCATTATACCAAAGCTATTGATATTTGGGCTATAGGGTGTATATTTGCAGAACTACTAACGTCAGAACCAATATTTCACTGTCGACAAGAGGACATCAAAACTAGTAATCCTTATCACCATGACCAGCTGGACAGAATATTCAATGTAATGGGATTTCCTGCAGATAAAGATTGGGAAGATATAAAAAAGATGCCTGAACATTCAACATTAATGAAAGATTTCAGAAGAAATACGTATACCAACTGCAGCCTTATCAAGTATATGGAAAAACATAAAGTTAAACCAGATAGTAAAGCATTCCACTTGCTTCAGAAGCTGCTTACCATGGACCCAATAAAGCGAATTACCTCAGAACAGGCTATGCAGGACCCCTATTTCTTAGAAGACCCACTTCCTACATCAGACGTTTTTGCCGGTTGTCAAATCCCTTACCCAAAACGAGAATTTTTAACGGAAGAAGAACCTGATGACAAAGGAGACAAAAAGAACCAGCAGCAGCAGCAGGGCAATAACCACACTAATGGAACTGGCCACCCAGGGAATCAAGACAGCAGTCACACACAGGGACCCCCGTTGAAGAAAGTGAGAGTTGTTCCTCCTACCACTACCTCAGGTGGACTTATCATGACCTCAGACTATCAGCGTTCCAATCCACATGCTGCCTATCCCAACCCTGGACCAAGCACATCACAGCCGCAGAGCAGCATGGGATACTCAGCTACCTCCCAGCAGCCTCCACAGTACTCACATCAGACACATCGGTACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T10822-Ab Anti-CDK8 monoclonal antibody
    Target Antigen GM-Tg-g-T10822-Ag CDK8 protein
    ORF Viral Vector pGMLV000486 Human CDK8 Lentivirus plasmid
    ORF Viral Vector pGMLV000933 Human CDK8 Lentivirus plasmid
    ORF Viral Vector vGMLV000486 Human CDK8 Lentivirus particle
    ORF Viral Vector vGMLV000933 Human CDK8 Lentivirus particle


    Target information

    Target ID GM-T10822
    Target Name CDK8
    Gene ID 1024, 264064, 709761, 498140, 101086278, 486035, 507149, 100050819
    Gene Symbol and Synonyms CDK8,IDDHBA,K35,RGD1560888
    Uniprot Accession P49336
    Uniprot Entry Name CDK8_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000132964
    Target Classification Kinase

    This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.