Human CDK8/K35 ORF/cDNA clone-Lentivirus plasmid (NM_001260.3)
SKU: pGMLV000933
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CDK8/K35 Lentiviral expression plasmid for CDK8 lentivirus packaging, CDK8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
CDK8/K35 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000933 |
Gene Name | CDK8 |
Accession Number | NM_001260.3 |
Gene ID | 1024 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1395 bp |
Gene Alias | K35 |
Fluorescent Reporter | Null |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACTATGACTTTAAAGTGAAGCTGAGCAGCGAGCGGGAGCGGGTCGAGGACCTGTTTGAATACGAGGGCTGCAAAGTTGGCCGAGGCACTTATGGTCACGTCTACAAAGCCAAGAGGAAAGATGGGAAGGATGATAAAGACTATGCTTTAAAACAAATAGAAGGAACTGGGATCTCTATGTCGGCATGTAGAGAAATAGCATTACTTCGAGAGCTTAAGCATCCAAACGTCATTTCTCTTCAAAAGGTGTTTCTGTCTCATGCTGATAGGAAGGTGTGGCTTCTGTTTGACTATGCTGAACATGACCTCTGGCATATAATCAAGTTTCACAGAGCTTCTAAAGCAAACAAGAAGCCAGTTCAGTTACCTCGGGGAATGGTGAAGTCACTATTATATCAGATCCTAGATGGTATTCACTACCTGCATGCTAACTGGGTGTTGCACAGAGATTTGAAACCTGCTAATATTTTAGTTATGGGTGAAGGTCCTGAGCGAGGAAGAGTAAAAATTGCTGACATGGGCTTTGCCCGATTATTTAATTCACCTTTGAAGCCTTTAGCAGATTTGGATCCAGTGGTTGTTACATTCTGGTACCGAGCCCCTGAACTACTTCTTGGAGCAAGGCATTATACCAAAGCTATTGATATTTGGGCTATAGGGTGTATATTTGCAGAACTACTAACGTCAGAACCAATATTTCACTGTCGACAAGAGGACATCAAAACTAGTAATCCTTATCACCATGACCAGCTGGACAGAATATTCAATGTAATGGGATTTCCTGCAGATAAAGATTGGGAAGATATAAAAAAGATGCCTGAACATTCAACATTAATGAAAGATTTCAGAAGAAATACGTATACCAACTGCAGCCTTATCAAGTATATGGAAAAACATAAAGTTAAACCAGATAGTAAAGCATTCCACTTGCTTCAGAAGCTGCTTACCATGGACCCAATAAAGCGAATTACCTCAGAACAGGCTATGCAGGACCCCTATTTCTTAGAAGACCCACTTCCTACATCAGACGTTTTTGCCGGTTGTCAAATCCCTTACCCAAAACGAGAATTTTTAACGGAAGAAGAACCTGATGACAAAGGAGACAAAAAGAACCAGCAGCAGCAGCAGGGCAATAACCACACTAATGGAACTGGCCACCCAGGGAATCAAGACAGCAGTCACACACAGGGACCCCCGTTGAAGAAAGTGAGAGTTGTTCCTCCTACCACTACCTCAGGTGGACTTATCATGACCTCAGACTATCAGCGTTCCAATCCACATGCTGCCTATCCCAACCCTGGACCAAGCACATCACAGCCGCAGAGCAGCATGGGATACTCAGCTACCTCCCAGCAGCCTCCACAGTACTCACATCAGACACATCGGTACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T10822-Ab | Anti-CDK8 monoclonal antibody |
Target Antigen | GM-Tg-g-T10822-Ag | CDK8 protein |
ORF Viral Vector | pGMLV000486 | Human CDK8 Lentivirus plasmid |
ORF Viral Vector | pGMLV000933 | Human CDK8 Lentivirus plasmid |
ORF Viral Vector | vGMLV000486 | Human CDK8 Lentivirus particle |
ORF Viral Vector | vGMLV000933 | Human CDK8 Lentivirus particle |
Target information
Target ID | GM-T10822 |
Target Name | CDK8 |
Gene ID | 1024, 264064, 709761, 498140, 101086278, 486035, 507149, 100050819 |
Gene Symbol and Synonyms | CDK8,IDDHBA,K35,RGD1560888 |
Uniprot Accession | P49336 |
Uniprot Entry Name | CDK8_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000132964 |
Target Classification | Kinase |
This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.