Human AKR1B10/AKR1B11/AKR1B12 ORF/cDNA clone-Lentivirus particle (NM_020299.5)

Cat. No.: vGMLV000888

Pre-made Human AKR1B10/AKR1B11/AKR1B12 Lentiviral expression plasmid for AKR1B10 lentivirus packaging, AKR1B10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to AKR1B10/AKR1B11 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000888 Human AKR1B10 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000888
Gene Name AKR1B10
Accession Number NM_020299.5
Gene ID 57016
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 951 bp
Gene Alias AKR1B11,AKR1B12,ALDRLn,ARL-1,ARL1,HIS,HSI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACGTTTGTGGAGCTCAGTACCAAAGCCAAGATGCCCATTGTGGGCCTGGGCACTTGGAAGTCTCCTCTTGGCAAAGTGAAAGAAGCAGTGAAGGTGGCCATTGATGCAGGATATCGGCACATTGACTGTGCCTATGTCTATCAGAATGAACATGAAGTGGGGGAAGCCATCCAAGAGAAGATCCAAGAGAAGGCTGTGAAGCGGGAGGACCTGTTCATCGTCAGCAAGTTGTGGCCCACTTTCTTTGAGAGACCCCTTGTGAGGAAAGCCTTTGAGAAGACCCTCAAGGACCTGAAGCTGAGCTATCTGGACGTCTATCTTATTCACTGGCCACAGGGATTCAAGTCTGGGGATGACCTTTTCCCCAAAGATGATAAAGGTAATGCCATCGGTGGAAAAGCAACGTTCTTGGATGCCTGGGAGGCCATGGAGGAGCTGGTGGATGAGGGGCTGGTGAAAGCCCTTGGGGTCTCCAATTTCAGCCACTTCCAGATCGAGAAGCTCTTGAACAAACCTGGACTGAAATATAAACCAGTGACTAACCAGGTTGAGTGTCACCCATACCTCACACAGGAGAAACTGATCCAGTACTGCCACTCCAAGGGCATCACCGTTACGGCCTACAGCCCCCTGGGCTCTCCGGATAGACCTTGGGCCAAGCCAGAAGACCCTTCCCTGCTGGAGGATCCCAAGATTAAGGAGATTGCTGCAAAGCACAAAAAAACCGCAGCCCAGGTTCTGATCCGTTTCCATATCCAGAGGAATGTGATTGTCATCCCCAAGTCTGTGACACCAGCACGCATTGTTGAGAACATTCAGGTCTTTGACTTTAAATTGAGTGATGAGGAGATGGCAACCATACTCAGCTTCAACAGAAACTGGAGGGCCTGTAACGTGTTGCAATCCTCTCATTTGGAAGACTATCCCTTCAATGCAGAATATTGA
ORF Protein Sequence MATFVELSTKAKMPIVGLGTWKSPLGKVKEAVKVAIDAGYRHIDCAYVYQNEHEVGEAIQEKIQEKAVKREDLFIVSKLWPTFFERPLVRKAFEKTLKDLKLSYLDVYLIHWPQGFKSGDDLFPKDDKGNAIGGKATFLDAWEAMEELVDEGLVKALGVSNFSHFQIEKLLNKPGLKYKPVTNQVECHPYLTQEKLIQYCHSKGITVTAYSPLGSPDRPWAKPEDPSLLEDPKIKEIAAKHKKTAAQVLIRFHIQRNVIVIPKSVTPARIVENIQVFDFKLSDEEMATILSFNRNWRACNVLQSSHLEDYPFNAEY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0571-Ab Anti-AK1BA/ AKR1B10/ AKR1B11 functional antibody
    Target Antigen GM-Tg-g-SE0571-Ag AKR1B10 protein
    ORF Viral Vector pGMLP004050 Human AKR1B10 Lentivirus plasmid
    ORF Viral Vector pGMLV000888 Human AKR1B10 Lentivirus plasmid
    ORF Viral Vector vGMLP004050 Human AKR1B10 Lentivirus particle
    ORF Viral Vector vGMLV000888 Human AKR1B10 Lentivirus particle


    Target information

    Target ID GM-SE0571
    Target Name AKR1B10
    Gene ID 57016
    Gene Symbol and Synonyms AKR1B10,AKR1B11,AKR1B12,ALDRLn,ARL-1,ARL1,HIS,HSI
    Uniprot Accession O60218
    Uniprot Entry Name AK1BA_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000198074
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member can efficiently reduce aliphatic and aromatic aldehydes, and it is less active on hexoses. It is highly expressed in adrenal gland, small intestine, and colon, and may play an important role in liver carcinogenesis. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.