Human AKR1B10/AKR1B11/AKR1B12 ORF/cDNA clone-Lentivirus plasmid (NM_020299.5)
Cat. No.: pGMLV000888
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human AKR1B10/AKR1B11/AKR1B12 Lentiviral expression plasmid for AKR1B10 lentivirus packaging, AKR1B10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
AKR1B10/AKR1B11 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000888 |
Gene Name | AKR1B10 |
Accession Number | NM_020299.5 |
Gene ID | 57016 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 951 bp |
Gene Alias | AKR1B11,AKR1B12,ALDRLn,ARL-1,ARL1,HIS,HSI |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGGCCACGTTTGTGGAGCTCAGTACCAAAGCCAAGATGCCCATTGTGGGCCTGGGCACTTGGAAGTCTCCTCTTGGCAAAGTGAAAGAAGCAGTGAAGGTGGCCATTGATGCAGGATATCGGCACATTGACTGTGCCTATGTCTATCAGAATGAACATGAAGTGGGGGAAGCCATCCAAGAGAAGATCCAAGAGAAGGCTGTGAAGCGGGAGGACCTGTTCATCGTCAGCAAGTTGTGGCCCACTTTCTTTGAGAGACCCCTTGTGAGGAAAGCCTTTGAGAAGACCCTCAAGGACCTGAAGCTGAGCTATCTGGACGTCTATCTTATTCACTGGCCACAGGGATTCAAGTCTGGGGATGACCTTTTCCCCAAAGATGATAAAGGTAATGCCATCGGTGGAAAAGCAACGTTCTTGGATGCCTGGGAGGCCATGGAGGAGCTGGTGGATGAGGGGCTGGTGAAAGCCCTTGGGGTCTCCAATTTCAGCCACTTCCAGATCGAGAAGCTCTTGAACAAACCTGGACTGAAATATAAACCAGTGACTAACCAGGTTGAGTGTCACCCATACCTCACACAGGAGAAACTGATCCAGTACTGCCACTCCAAGGGCATCACCGTTACGGCCTACAGCCCCCTGGGCTCTCCGGATAGACCTTGGGCCAAGCCAGAAGACCCTTCCCTGCTGGAGGATCCCAAGATTAAGGAGATTGCTGCAAAGCACAAAAAAACCGCAGCCCAGGTTCTGATCCGTTTCCATATCCAGAGGAATGTGATTGTCATCCCCAAGTCTGTGACACCAGCACGCATTGTTGAGAACATTCAGGTCTTTGACTTTAAATTGAGTGATGAGGAGATGGCAACCATACTCAGCTTCAACAGAAACTGGAGGGCCTGTAACGTGTTGCAATCCTCTCATTTGGAAGACTATCCCTTCAATGCAGAATATTGA |
ORF Protein Sequence | MATFVELSTKAKMPIVGLGTWKSPLGKVKEAVKVAIDAGYRHIDCAYVYQNEHEVGEAIQEKIQEKAVKREDLFIVSKLWPTFFERPLVRKAFEKTLKDLKLSYLDVYLIHWPQGFKSGDDLFPKDDKGNAIGGKATFLDAWEAMEELVDEGLVKALGVSNFSHFQIEKLLNKPGLKYKPVTNQVECHPYLTQEKLIQYCHSKGITVTAYSPLGSPDRPWAKPEDPSLLEDPKIKEIAAKHKKTAAQVLIRFHIQRNVIVIPKSVTPARIVENIQVFDFKLSDEEMATILSFNRNWRACNVLQSSHLEDYPFNAEY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0571-Ab | Anti-AK1BA/ AKR1B10/ AKR1B11 functional antibody |
Target Antigen | GM-Tg-g-SE0571-Ag | AKR1B10 protein |
ORF Viral Vector | pGMLP004050 | Human AKR1B10 Lentivirus plasmid |
ORF Viral Vector | pGMLV000888 | Human AKR1B10 Lentivirus plasmid |
ORF Viral Vector | vGMLP004050 | Human AKR1B10 Lentivirus particle |
ORF Viral Vector | vGMLV000888 | Human AKR1B10 Lentivirus particle |
Target information
Target ID | GM-SE0571 |
Target Name | AKR1B10 |
Gene ID | 57016 |
Gene Symbol and Synonyms | AKR1B10,AKR1B11,AKR1B12,ALDRLn,ARL-1,ARL1,HIS,HSI |
Uniprot Accession | O60218 |
Uniprot Entry Name | AK1BA_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000198074 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member can efficiently reduce aliphatic and aromatic aldehydes, and it is less active on hexoses. It is highly expressed in adrenal gland, small intestine, and colon, and may play an important role in liver carcinogenesis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.