Human VSIR/B7-H5/B7H5 ORF/cDNA clone-Lentivirus particle (NM_022153)

Cat. No.: vGMLV000880

Pre-made Human VSIR/B7-H5/B7H5 Lentiviral expression plasmid for VSIR lentivirus packaging, VSIR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to VSIR/B7-H5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLV000880 Human VSIR Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLV000880
Gene Name VSIR
Accession Number NM_022153
Gene ID 64115
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 936 bp
Gene Alias B7-H5,B7H5,C10orf54,DD1alpha,Dies1,GI24,PD-1H,PP2135,SISP1,VISTA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCGTCCCCACGGCCCTGGAGGCCGGCAGCTGGCGCTGGGGATCCCTGCTCTTCGCTCTCTTCCTGGCTGCGTCCCTAGGTCCGGTGGCAGCCTTCAAGGTCGCCACGCCGTATTCCCTGTATGTCTGTCCCGAGGGGCAGAACGTCACCCTCACCTGCAGGCTCTTGGGCCCTGTGGACAAAGGGCACGATGTGACCTTCTACAAGACGTGGTACCGCAGCTCGAGGGGCGAGGTGCAGACCTGCTCAGAGCGCCGGCCCATCCGCAACCTCACGTTCCAGGACCTTCACCTGCACCATGGAGGCCACCAGGCTGCCAACACCAGCCACGACCTGGCTCAGCGCCACGGGCTGGAGTCGGCCTCCGACCACCATGGCAACTTCTCCATCACCATGCGCAACCTGACCCTGCTGGATAGCGGCCTCTACTGCTGCCTGGTGGTGGAGATCAGGCACCACCACTCGGAGCACAGGGTCCATGGTGCCATGGAGCTGCAGGTGCAGACAGGCAAAGATGCACCATCCAACTGTGTGGTGTACCCATCCTCCTCCCAGGATAGTGAAAACATCACGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCCTCCAACCGCCGTGCCCAGGAGCTGGTGCGGATGGACAGCAACATTCAAGGGATTGAAAACCCCGGCTTTGAAGCCTCACCACCTGCCCAGGGGATACCCGAGGCCAAAGTCAGGCACCCCCTGTCCTATGTGGCCCAGCGGCAGCCTTCTGAGTCTGGGCGGCATCTGCTTTCGGAGCCCAGCACCCCCCTGTCTCCTCCAGGCCCCGGAGACGTCTTCTTCCCATCCCTGGACCCTGTCCCTGACTCTCCAAACTTTGAGGTCATCTAG
ORF Protein Sequence MGVPTALEAGSWRWGSLLFALFLAASLGPVAAFKVATPYSLYVCPEGQNVTLTCRLLGPVDKGHDVTFYKTWYRSSRGEVQTCSERRPIRNLTFQDLHLHHGGHQAANTSHDLAQRHGLESASDHHGNFSITMRNLTLLDSGLYCCLVVEIRHHHSEHRVHGAMELQVQTGKDAPSNCVVYPSSSQDSENITAAALATGACIVGILCLPLILLLVYKQRQAASNRRAQELVRMDSNIQGIENPGFEASPPAQGIPEAKVRHPLSYVAQRQPSESGRHLLSEPSTPLSPPGPGDVFFPSLDPVPDSPNFEVI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-406 Pre-Made Onvatilimab biosimilar, Whole mAb, Anti-VSIR Antibody: Anti-B7-H5/B7H5/C10orf54/DD1alpha/Dies1/GI24/PD-1H/PP2135/SISP1/VISTA therapeutic antibody
    Target Antibody GM-Tg-g-T99704-Ab Anti-VISTA/ VSIR/ B7-H5 monoclonal antibody
    Target Antigen GM-Tg-g-T99704-Ag VSIR VLP (virus-like particle)
    ORF Viral Vector pGMLP004294 Human VSIR Lentivirus plasmid
    ORF Viral Vector pGMLV000879 Human VSIR Lentivirus plasmid
    ORF Viral Vector pGMLV000880 Human VSIR Lentivirus plasmid
    ORF Viral Vector vGMLP004294 Human VSIR Lentivirus particle
    ORF Viral Vector vGMLV000879 Human VSIR Lentivirus particle
    ORF Viral Vector vGMLV000880 Human VSIR Lentivirus particle


    Target information

    Target ID GM-T99704
    Target Name VSIR
    Gene ID 64115, 74048, 709595, 690899, 101096355, 106558705, 783068, 102149832
    Gene Symbol and Synonyms 4632428N05Rik,B7-H5,B7H5,C10orf54,C1H10orf54,C28H10orf54,C4H10orf54,C9H10orf54,C9orf54,CD2H10orf54,DD1alpha,Dies1,GI24,PD-1H,PP2135,SISP1,VISTA,VSIR
    Uniprot Accession Q9H7M9
    Uniprot Entry Name VISTA_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000107738
    Target Classification Checkpoint-Immuno Oncology

    Enables endopeptidase activator activity; enzyme binding activity; and identical protein binding activity. Involved in several processes, including negative regulation of cytokine production; positive regulation of macromolecule metabolic process; and regulation of T cell activation. Located in plasma membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.